Description :
From Genome Similarity Track
Location :
Scaffold_1941:3587- 4815
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1941-fgenesh-gene-0.0Rab32 family GTPase

Sequence
1228 bases(100 bases per row)
GACAATGGCCGAACGCCGCGTGAACGCCGCGCAAGACGCCGTGATCAAAGTGCTCGTGCTAGGCGACGCCGCTACGGGCAAGACGAGCATCATTAAGAGG
TGCGTGCTGTTGCCATGTGTCTCTTGCGTTATGCGCTCTTGAAGTGCGAGCGCGGAGAAAAAAAGGTATCCACTATGGGCGCGAGGAGCTACGCAAAGCT
AACGGGTGTGTTTGTGATGTGTATGTGTATGACTGTATGTGTGGTGTAGATACGTGCACGATGCGTTCTCGGAGCACCACCGCACGACGATTGGCGTCGA
CTTTGCGCTCAAGGCCGTGACGGTGAGCGGCACGACCGTGCGGCTGCAATTGTGGGATATCGCCGGTACGTGTGCGCCAGAGTTCTTGGATTGAGCCATG
GGTGTGCGCATAGGGTAACATCTTGGGTGATTGTTGTCTTGTGTGTTTCTGTAGGCCAAGAGCACTTTCGCGCATTGAACCGAGTGAGCATCTGCTAGAG
GATCGGGCCATTAGCTGTGAGACCTGTGGACTGATTTTATACGGATCGTGTGTAGGTGTATTACAAGGACGCGCTCGGTGCTCTGCTGGTGTACGATATC
TCTCGTCCGGAAACCTTCGAGAGCGTCATCAAGGTATGAATGAGCGTATCCTTTTGTCGGCGGCGTGGTACCTCGCATTGAGAAGTTGACACAAGTGTAT
GTGGTTTCTAATTCATTCTAACCGATACAGTGGAAGAAGGAGATCGACACAAAGGTGCGCTGAGAACGTTGCGGTATTTTAGCTCGTATTTACCATCTGT
CAAGTGCTGATGCGTGTTGCTATGCTTTTAGGTCGAGCTCCCGAACAACAAGCCGCTCCCAGTGATTCTGTGTGGCAACAAGGTAATGATCGTCTGCCAG
TCTTGCCTCGACAATTCAATGTTGGCTCCAGTCGCCTAATCTAATTTGTGTGTATTTTCTTACTGTCCAGTGCGACTTGTCTGGAGACGTCGATCGCAAC
TTCTTGGACGCATTCTGCGAGACGAACGGCTTTGCCGGCTGGTTTGAGACGTCGGCGAAGGAGAACAAGCACATCGACGACGCGTCCAAGGCCCTGGTGA
ACAGCATCCTGGAGCACCAGGATATCTTTGAGCGCAAGTCCGACGTGAGCAAGCGCAACGACACGTTCCGTCCGTCGCACGCGGACACGAGGAGCTCGCA
GTCCGGCTGGTGCTGCAGCAGCTTTTAA