Description :
From Genome Similarity Track
Location :
contig_37:35857- 39290
Transcript NameFunction/comments
g8880.t1hypothetical protein
g8881.t1hypothetical protein

Sequence
3433 bases(100 bases per row)
CAATCCGCAGTCGCGCACCGAGCGCAACAAGGTCGTGAAACACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGTGGCATTACGAGCCACTCCCAG
AGGATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAG
TACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCACCGGTACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCG
CCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCG
TCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCT
GCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGCAAAAGGGCCCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCG
AAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCACTCTCTCGACGTCCGAGA
GGATACAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGG
ATTCTCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGATTCAACGATTGGCTCCAACTCCTGCGTCTGCCCGGCA
GACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCTGCTCCGCGAGTTTCTT
CTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGTTTGATTGCGCACCGCTTC
GTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCG
TCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGCGTCGCTCCGGACGCTTCGAGACC
CTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGTTTCACATTTTATTCCAACGACTCTCGCAGTCGTTGTCGTTCGCTTGGGGTGATCGGAGACAGC
CGCATTCCGCGCTATCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCGCCGACAGGGCCAGCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAG
TGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGATCGTC
GACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGA
GGTGTTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCTACTAGAGCACGAAGAGACTTCTCT
CTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGT
GTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCA
CGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCT
GCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATG
CAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGC
CCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAG
CATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAA
CTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTC
GACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGT
GGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACC
GTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGAC
AGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGT
ATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCG
CACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTG
GTGCTGAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTAT
CTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGT
GCCTTAGTGCATGTTGCACTAAGGTGGGAGGTG