Description :
From Genome Similarity Track
Location :
Scaffold_332:35852- 37983
Transcript NameFunction/comments
Phypl_g7083hypothetical protein PHYSODRAFT_518543
Phypl_g7084hypothetical protein PHYSODRAFT_256009

Sequence
2131 bases(100 bases per row)
GCGCATCTGCGGCGGCTCGAATGGGTACCTAAATAAGTTCCCCGGTAGCAACGAATTAGCATCTAAAACCTAGCAATTAAGCccgcagatgcagcagcga
gttaCGTACTTGGGCGGGATGacgatctccagctcgaagtgGCCGCCCTCGTACGGCGTCGCCTCGGGCCCCTGGATAGAgccgcgcagctccgagAGCG
ACTCGGCGTCCACCGGCACGGCCGTGACGCCCGACAGGTGCGAGTCCTTCTGGcactcctccagctccttgcgcaCGCGACCTGCTACGGCAGTGACGGC
GTTGAATCAGCAGCTATTCTAGCGACGTTTTGCTCCTTCGCGGCTCACCTGGAGCCATCTTGCCTTTGATTGAATAATAGTGATGTACTATACCCCAAGA
GAATATGGTGTGGACGACGTAAATATCATGTAAATTCACCTAACACTGTAAGAGCGACCCAATCCGCATTATGGTCGACACGGTGGCCAAGCCGACGCGG
AAGCGCGGGCGCGGCGTGGGCCCGCGGCTCaacgacctgcagcgcctggagaTCATCCACAAGCATAAGAGCTCGCAGCCGCCGACCTCCttgcgccagc
tcgcgcgcgacttcggcgtggacgagaagtCCATCCGCCGGGTCGTCAACGCGGCCGCGGACATTGaggcgcgcgccagctcgtccgcggCCTTAAACAG
GAGGTCGCACGTGCACCGCCGCCCCACGCCGCGCTTcccgcagctggagaagacgctgtcggccTGGATCGACGCCCGGGAGCGGGCGAAGGCCGACATC
TCGCCCTCCGTGGTCAtcgacaaggccaagttGGTGGCGCGAGCCATGGGCATCAGCCCGGACGACTTCAAGGCCAGTTGGGGCTGGTACGACAAGTTCA
GCAAGAGATACGGCATCCACACGGCCTTCGTGAGCAGCGGAGGGGGCGAGGGGGACAGGAAGCCACTCAGAGAGACCACGAgtctgcaggagctgcaccg
GGTGATGACGCAGTACGACCCCGAGTGGGTCTTTACAGTTGAAGAAACGTCGTTGTTTTATGACGCGCTGCCTTTTGGTGCAGACGCGGGGGGGAACAGG
AAGCGAGTGACActcgtgctgtgctgcaacTCGACCGGACGGGTGACGCTGCCCGTCTGCATGGTCGGGAAGGACTCCTCGTGTGGACGCaacgcggcgt
ccagcttccCGCTGCCGTACTTGGAGCAGAACAGGGCGTGGCTGGATCGACCGACGTTCGGAAGCTGGTATAGCTCCGTGTTCGTGCCGTTTGTGCGCGA
ACGCACGAGTAAaccggcgctgctggttgtggaTGGAGAACGCCCCGGACACCAAGGGAACTTTGAAGACGACAGCGTTCGACTGGCGTTCTTGCCGGCG
ACACAGGCTCCGACTGAGACAGTAACGGCTGCGAAGATGACGAATCCGAAGACTTGGTGGAGTAGGCCGTTGGGGGTGGGtgtcgtggtggcgctcaAGG
CGAAGTATAAGTTTCTGCTCGTACAGAGCGTGCTGTCGTACCACAACGCTCCAgaggaggtgaaggtggCCCTCAAGGCAGCGGAAGAAAGAGACAACCG
TCATGGAGGCGGCGTGCATTTCGGCCGCGCACCGACATTGCTGGACGCTGCACGGTTGCTGGAACAGGCCTGGGGCCAGGTGCCTGATGGTTTATTGCAA
AACTGCTTCGCGCGTGCTAACTTGATCCCGCCATCAAAGTTGTTGGCACCTTCCGCTCCTCCAACGGGGATGAGTGCTCTAGAGGAGCAGACTCAGGAAT
CGATGCGCTATAACGATGAGATTGCTGGCAAGATtgaggagatgctgctgccaagctcCCTCGATGCTCGTGTCTGGGCCATGAACGAGCAGCATCCACC
AGCTAATCTAAGGGATCGCATTCGAGCGTTCATGCACCTGGATGATGAGAACTCATTCGAGCTGCGGAGGCAACTACAAGGCGAGATTAACGAAGCTCTG
AGTGATGTGGTTCCGTCGGCGCCAGCATCCGATTCGATCATACCAGCTCCTAGTATCGATACAAGTGACAGCGATATCGGTGAGGCCGATCCGGAAAAAC
CCGACTTGCAGTCCCAAATTCGTGGAGTACT