Description :
From Genome Similarity Track
Location :
Scaffold_332:35851- 37867
Transcript NameFunction/comments
Phypl_g7083hypothetical protein PHYSODRAFT_518543
Phypl_g7084hypothetical protein PHYSODRAFT_256009

Sequence
2016 bases(100 bases per row)
AGCGCATCTGCGGCGGCTCGAATGGGTACCTAAATAAGTTCCCCGGTAGCAACGAATTAGCATCTAAAACCTAGCAATTAAGCccgcagatgcagcagcg
agttaCGTACTTGGGCGGGATGacgatctccagctcgaagtgGCCGCCCTCGTACGGCGTCGCCTCGGGCCCCTGGATAGAgccgcgcagctccgagAGC
GACTCGGCGTCCACCGGCACGGCCGTGACGCCCGACAGGTGCGAGTCCTTCTGGcactcctccagctccttgcgcaCGCGACCTGCTACGGCAGTGACGG
CGTTGAATCAGCAGCTATTCTAGCGACGTTTTGCTCCTTCGCGGCTCACCTGGAGCCATCTTGCCTTTGATTGAATAATAGTGATGTACTATACCCCAAG
AGAATATGGTGTGGACGACGTAAATATCATGTAAATTCACCTAACACTGTAAGAGCGACCCAATCCGCATTATGGTCGACACGGTGGCCAAGCCGACGCG
GAAGCGCGGGCGCGGCGTGGGCCCGCGGCTCaacgacctgcagcgcctggagaTCATCCACAAGCATAAGAGCTCGCAGCCGCCGACCTCCttgcgccag
ctcgcgcgcgacttcggcgtggacgagaagtCCATCCGCCGGGTCGTCAACGCGGCCGCGGACATTGaggcgcgcgccagctcgtccgcggCCTTAAACA
GGAGGTCGCACGTGCACCGCCGCCCCACGCCGCGCTTcccgcagctggagaagacgctgtcggccTGGATCGACGCCCGGGAGCGGGCGAAGGCCGACAT
CTCGCCCTCCGTGGTCAtcgacaaggccaagttGGTGGCGCGAGCCATGGGCATCAGCCCGGACGACTTCAAGGCCAGTTGGGGCTGGTACGACAAGTTC
AGCAAGAGATACGGCATCCACACGGCCTTCGTGAGCAGCGGAGGGGGCGAGGGGGACAGGAAGCCACTCAGAGAGACCACGAgtctgcaggagctgcacc
gGGTGATGACGCAGTACGACCCCGAGTGGGTCTTTACAGTTGAAGAAACGTCGTTGTTTTATGACGCGCTGCCTTTTGGTGCAGACGCGGGGGGGAACAG
GAAGCGAGTGACActcgtgctgtgctgcaacTCGACCGGACGGGTGACGCTGCCCGTCTGCATGGTCGGGAAGGACTCCTCGTGTGGACGCaacgcggcg
tccagcttccCGCTGCCGTACTTGGAGCAGAACAGGGCGTGGCTGGATCGACCGACGTTCGGAAGCTGGTATAGCTCCGTGTTCGTGCCGTTTGTGCGCG
AACGCACGAGTAAaccggcgctgctggttgtggaTGGAGAACGCCCCGGACACCAAGGGAACTTTGAAGACGACAGCGTTCGACTGGCGTTCTTGCCGGC
GACACAGGCTCCGACTGAGACAGTAACGGCTGCGAAGATGACGAATCCGAAGACTTGGTGGAGTAGGCCGTTGGGGGTGGGtgtcgtggtggcgctcaAG
GCGAAGTATAAGTTTCTGCTCGTACAGAGCGTGCTGTCGTACCACAACGCTCCAgaggaggtgaaggtggCCCTCAAGGCAGCGGAAGAAAGAGACAACC
GTCATGGAGGCGGCGTGCATTTCGGCCGCGCACCGACATTGCTGGACGCTGCACGGTTGCTGGAACAGGCCTGGGGCCAGGTGCCTGATGGTTTATTGCA
AAACTGCTTCGCGCGTGCTAACTTGATCCCGCCATCAAAGTTGTTGGCACCTTCCGCTCCTCCAACGGGGATGAGTGCTCTAGAGGAGCAGACTCAGGAA
TCGATGCGCTATAACGATGAGATTGCTGGCAAGATtgaggagatgctgctgccaagctcCCTCGATGCTCGTGTCTGGGCCATGAACGAGCAGCATCCAC
CAGCTAATCTAAGGGATCGCATTCGAGCGTTCATGCACCTGGATGATGAGAACTCATTCGAGCTGCGGAGGCAACTACAAGGCGAGATTAACGAAGCTCT
GAGTGATGTGGTTCCG