Description :
From Genome Similarity Track
Location :
scaffold_57:35850- 38985
Transcript NameFunction/comments
g2326.t1 hypothetical protein PHYSODRAFT_262310
g2327.t1 flavodoxin/amb allergen/pectate lyase

Sequence
3135 bases(100 bases per row)
CTTACACGGTCGGCCAGCCACTTGAGAAGTCGAGTTGGTTCCAGCCGAACTTCTTGTCTCCATCCGCGTACCCGATACGCGTGTCCACTGCAACGAAAGA
GAAAAGTGAGAACTAAATAAAAACAAACAAAAAGATAATAGGGTATCATACGCTCCTTACCGTAATGGTAGTACACCACCGGCCCGTACTTCGGATCATT
GTACACACCCTGGCCCCCCGGTCCGTACACGTAGTCATGGGACTCCAGTACGACCGTGCCACCGTTGTTCTTGCAGTCCGCACCGTTCTTATCGACGAAA
CCGGACGTAGCGTGCTTCGAGCGGCACACAAGAATCCGGTACTCTTTACCCTTAGCTGGGCGTGTTTTGTCGTAGCCGCAGCACGAGCCCTTAGAGAAGA
AGAGATAGTAGTAGCCATTGTACGAGAACGTGTACGCAGCCTCCACGACCTCGTAGTTAGAGGTGAACGCCATCTGATAGGCTGCTGCGCCTCCAGCTTT
CGTGGGAGTTGATTTCATCTTGACTTGGTACAGGTCCTGCCAGTAGCTACCGAAGGTGAGGAAGTATTGGCTGCCCACTTGGAACAGGTTCGGGTCGATG
GCGTTGTATTTCTTGGATGAATCACTGGTAACGCCGATGCTCCCCAAATCCGTCCAGGATCCGGCTTCCATGGTTTTGGACCGGGTGAGACCGATAGCTG
AGTTTTGCGTGCCAAAGGAGCTTACGGAGTAGTACAGGTAGTACATATCTCCAACCTTGTGCACGTCGGGAGCCCATAGGTCGTCCTTGCCCGTCAGGTT
GATCTTTGAACCGCTGGGGACGGCAGCGCCCAAGTACGTCCAGGGTCCCGTCAGCGCCGGAGCCGAGTGGATAGCGATTTTGTTACCCGTGGAGAAGCGG
AAGTACGTGCCATCATCGCGTCGAATGATGGACGGATCGTGTGCGTTGGTGCACGTGCCGGTGCACAGCTTCGGGTTGGCATAACCGTTGACAACACTTG
CAAGTAGCAACGGTAGACCGACGAGGAGGGAAAAGAGCTTCATGGTTAAAGTCGACAGATCCGAAGTGAGAGGCGTGTGGAAAACAACGGACCGTTCGGT
AAAGGATGAACTTCTCACTACTGGCGATCACGCGTCTTTGACGTGTGTATGGAACAGGTCCCGCTCGAGCAGCGAGACGACGCACTGATGCAAAAGGAGC
TCCGCCTGCATCAAGAAGGTTGCTGCTTGAACGAGCGGCAAAAACTGCTTTCAACCTTGAAGCATTTTTCTGTACGACCAACGTTTTTTCTTGAACTGCT
GGTCGTACGGAAAACGAAGATGTAGAAGACAGGTCCGACGTGAGGATGTTCCTGAACGAACTCTCTTCAAGAGGTCGACAATGTGGTCGACAATGTGTGT
GAGTACGGTAGGTTAATGCTGGCATGTATACTTGAGCAACGTGGCTTTGTATTGACTTCGTTATCATTTTGAAAGGATTTCGGGAAGCCTACGCCGTCTA
CAGAAAACAAATACATCCATCTACTTAAGTTGCTTCACTCCATTGGCTTAGTTGAGCACGCCAATGCCAAAGTTGTTGGTGGTCTTGCTCCACTGCACGG
CGGAGCGCGGGCTGTAGCCGGTGATGGCCGAGTACGACTTGACCTTCGACAGAGCCGTCCCGCCGTTGCGTGAGCCCCACGCGCCGCTGTTGGACACCAC
ATTGGCGACGCACGAACGACCCAGGTAGCTGTTGCACTCGGTGGTGGCAGTAGCAGCGTACATGTTGCCGTCCGTTCCGGTCAGCAATGGCATCGTGGTG
TCCTTGAAGTAGTTTCCTTCGGCCAGGATCCACGAGTTGACGCCGACCTCGAACGAATGGCCCGAGTTGTCCGCCCAGTAGTTGTTGGCGATGTGGGCGA
TGACGTTAGCGCTGCTGTCACCGCCGAGCTTTGGCGAACGACCCGACGTCGAGTGGATGTAGTTGTTGACCATGCTGAAGCGCGTGTTCTTGCCGTAGAA
GATGAACGACCAGTAGTGGCGGCCATCGCACGTCGCCGAGTAGTCCGTACGACCGTCGAAGTCCGAGTTACTGATGGTCATTGTTGATACGCTGGCAGCG
TTCGTCGTGAGGAACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGATCTTGCTCATGGCCGTGGAGCCGCCGTTGCTGCCCTGGATGTACA
AGGCGTCGCCGCCCCAGACCAGGTGGCGGTTGAGCTCCGTGATGTGGACGTTCTGGATGATAATGTTGTCGCCGTTGAGCCACAGACCCTTGCCCATGAT
CACGCCGGTCGTGCCGATGCCGCGCAGGGTCTTGTTGCTCGTCACCGTCATGGGGGTGATGGCAGCGTTGTCGTACGTGACCGTCACGCTCGTGCCGTCC
GAGCATCCACCCGTGTTGGACATGCCTCCGCTCTGGAGGATCACATCTTGACTCTTGTAGCCGTTGTTCTTGGCGATACACTCGCGGGTGTAGTCCGGAC
GGCAACCGGCCTCGGTTGTGGTGCCCTCCGTGCCACGGAAGTCGAACGTCTTGTTCAGCACGATCACGCGCGGCACGGCGTCCTTCAGGTACGCCACGAG
CTGCGCCGTCGTGGTTGGGTACACGGCGGTAGCACTGCCGCCACCCGTCGTGCCGGCGGCGAGGCCGGTGGCTGAACCGACCGTGAAGGCCTCAGTGTTC
TGCACGAAGAGAGCCACCACCGCGATGAGAATGGGACGGAAGAACTTCATTAGTGATGGAGCTTGAACGGTCTTGTGCCAGGCGAAGCAAATTGAGATAT
GGAGACTGGAGAAGGTGGTGACTCCGTTGGCATCTCTGTGTCCCGCTGTTAGAGAGGGCGGTCAGTGCGCGCTCGTCCAGCATAAGGGGGCTCGAGGTGA
TCGTTCCGGCACGGAAAGCTTGCTTGACTCTGGTTGCACACGCATCGCGTGAGCTCCATCGTTCCAGCTGGTGTCAAGCTCTTTGCGACTAGCAATACGA
GCCATTTCACCAGCTGTGCACGCAACACCGCGAAATGGAGAGGGCGGGAGCGATCGTTGATTCTTGATTGAAAAGCGAACGCGAGTCATGACGCCGCGGG
GAAACTAATGCCGCCTCAACGCGACGGTCACAGCG