Description :
From Genome Similarity Track
Location :
contig_37:35843- 39275
Transcript NameFunction/comments
g9305.t1hypothetical protein
g9306.t1hypothetical protein

Sequence
3432 bases(100 bases per row)
CAATCCGCAGTCGCGCACCGAGCGCAACAAGGTCGTGAAGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAG
AGGATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAG
TACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCGTCGTTCAGCATGTTGTAAGCATGAACGATGCG
CCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCG
TCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCT
GCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGCAAAAGGGCCCACCTTGAGCGAGTCCCAGCCTTGCTCGTCG
AAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCACCCTCAGAGATGAGCTGCCTCAGCTCTTCTGTTTCACACGTCACTCTCTCGACGTCCGAGA
GGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGG
ATTCTCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTTTCAACGGTTGGCTCCAACTCCTGCGTCTGCCCGGCA
GACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGGCTTGCGCAGCTTTGCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCTGCTCCGCGAGTTTCTT
CTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGTTTGATTGCGCACCGCTTC
GTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTCCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCATAGCCGACGCG
TCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGCGTCGCTCCGGACGCTTCGAGACC
CTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGTTTCACATTTTATTCCAACGACTCTCGCAGTCGTTGTCGTTCGCTTGGGGTGATCGGAGACAGC
CGCATTCCGCGCTATCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAG
TGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGACATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGATCGTC
GACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGA
GGTATTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTC
TCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTG
TCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCAC
GACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTG
CTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGC
AGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCC
CATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGC
ATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAC
TCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCG
ACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTG
GAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCG
TGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACA
GGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTA
TTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGC
ACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGG
TGCTGAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATC
TATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGTG
CCTTAGTGCATGTTGCACTAAGGTGGGAGGTG