Description :
From Genome Similarity Track
Location :
Scaffold_72:358349- 363101
Transcript NameFunction/comments
Phyin_T30-4PITG_18393Putative uncharacterized protein

Sequence
4752 bases(100 bases per row)
ATTCGGTCGGCATTCGAGGAGTCCTGGCAAGTGGCAATGGAAGAAGAGTTAAATTCACTGCGCCGACGTGGGGTTTGGCGGGTGGTGAATCGAACAAAAG
CTGGAAAGGAGATTGTTATCACTAACAAGTGGATATATACTGTGATGAAAGATGAAAACGGGTTTGTGGTGAGATTTAAAGCACGTCTTGTCGTTCATGG
TTTTAAGCAAAGATTTGGAGTCACTTACAATGAAACTTTCGCCCGGGGCATTCGCTTTGACACAATCCGAGTAGCTATTAACTTTGCAGTACCCTGGCGG
TGGTCAATTTTGCAGTATGATGTTAAATCGGCTTTTCTGCATGGTAAATTGTTATTGGTGGTGTTCATGGAGTTACCTCAAGGCTGCGGTTCGACAGGAA
ATCAGCAGATCTGTCAATTGGTTAAATCTCTGTACGGTTTGAAACAAGCACCACATGCGTGGAACAAGATGCTGCATACTCATTTGGTTGCGCTTAGATT
TGCTCGCATGGAAAGTGATGACGGCCTTTATTCTCTCCTCGAGAAGGGGGGTTGTTATGCTCCTAACCGTCTACGTCTACGACCTACTTTTGATGGGGGA
GAATTATCTCTGCGAAGATATTGCACGAAAACTAGCGTCAAGCTTTGAAGTTGTGGCTCTTGGCCCAGTTAAGTATCTTCTCGGAGTTGAAGTCACTGTT
GATCGGGAGAAGAGCCAGGTATAGCTCAGCCAAGCTAGCTACATTGATGAAGTTCTCCGAAGATTTCATATGCACGAGTGCCACGGAATTGCTACACCAG
AACCAACATCCACTGAAGAAGAACCTACTGTTGAAAATGCTAGTGATACAAGCAGTTTGCCGTTCCGTGAAGTAGTAGGAGCACTGCAATATATCGTGTC
GGGATCAAGGCCGGATATCGCTCACGTCGTGCGTCGACTAGGACAGTTCTTTTCTTGCTTCACAGCACTTCACTACGCACGGGCAAAGCGGGTCCTTCGT
TACTTGAAGGCGAGTAAGGTGTATGGACTGAACATGGAAGTGACAGGAGTGGACAAGCTGGAGTTGCAGTGGCTGGAAGCTTTTAGTAATGCGGACTACG
CAAACGACAAAATTGATCGACAGTCTGTAAGTGGATATGTTACTATGATCAATGGTAGTGTCATCTCGTATGGGTCTCGCAAGCAAGGTCTTAACGCTCA
AAGTACCATGGAAGCCGAATATATCGCAATGAATGAAGGTGCACGCGATATTATGTGGTTAAGTGGTCTGTGTGATGAATTGTTGTGGAAATACAACACT
CCAACACTTTGGTGCGATCACACGGCTGCAATACCATTGTCGAAGAAGCAAGGAAAGCACAATGGCAGTAAGCATATTGAAAACAGGTTTCATTACGTGC
GGAGCCTTGAAGATCGTGAGCGACTGCAAGAGCAGCACTGCGGTACCAACGAAATGATCGCAGATATTTTAACCAAGCCACTCGCACGAGTAAAATTCCA
GTATTTCCGATCACTTGTTGGTGTTGGTTGCCGAGGAGAATCAGGGGAGGATAGTATGCAGCCCTCACAAGACAATGAAGCTACTGTATTAGTGCTGATC
TTGGCGAAGTCTCAAGAGAGAGGCAATCGATCGGAGTAGTCAATCCTCGTAGATGCGACTAGTGCAAGGCTGACAACGATGTGCTCGTTGAAAAAAATAT
TTTTCGCGACGTTCGCGTGTCTACGATGTTCGTAGTGCGGAGCTAAGCGTCGCCAATGTTCGTAATGTGCGCCCGAGTCAACGATGTTAGTGTTCAGCCC
CAGAATCCACGAGGGTCGTGGGTCAATGGTGACGTTCACCTGGTTAAGCGAAGGTCGCATGTTTACTTGAGTTCTAAAGACTACGGAGTTCGTAAAGGTA
GCGTGACGCGAGTAAGGGGGAGTGTCGGAAAATTCCTCTGAGTCTTATGCTCACGTCCTTCGATATAATAAGGCTCTCTAGTTAGAATGCTACATATAAT
GTATGTAGGATCCGTGAGGACACGAGGCTTGTGAGGAGAGTCTTTTTCATTCGTGAAAGCTCCACTTCCCCACCTAGCGTCGTGTCCAAGATCCCGGAGG
CTTTGCCCCTCCATCCAGCGTTCAAGTCTTTCATCTGCGCTATGGCAACTATTCAAGACCTTCAACTTCAGCTCTCATGACGATGCTGTCAAACTGGAGT
CTCAAGTCGCAGACAATCCGACTGTGGAGAACAAGAATACAGTCTTATAGCAGATGACGGAGAGGGCGTTACAGTCACTGCAAGCTGACCGCGACGAGCT
CTCTGAAGCTGAGTCTCGTGCTGCTGTAGTAATAGGAGGAGAGAGATGCTGTAAATCTATTACTGCAGCAGAAGCCGTACAACGGGTCGACTGCTCAACG
TGAGGAAATGCAGAAAACAAGTCGAAGACCTTAAAGCTGAACTCCGAAGCACACAGGAGAAGCATTCAGAGGAAGCTGACGCAGCTGACGAGACGATTCG
GTCACGAAAGGATGTTGAGACGACGGTAACGGCGTCAATGGAGTCTCTCAAGCGGGATCTGGCTGAAGCCGAGTCTTGCGTTATGGTGTTGGTGGAAGAG
CAAGACGCAGCACGAAAGGATCTTACTGCGTAGGATATGAAAATTAAGGTGATGACTTCCCAGCGAGGAGAGCTAGAGCTCGCAGCGCAGAAGCATGAAA
TTTAGCTGAACACGCTGCGGAGTAAGCTCTCAGCCGATGCAGAAGTCACGAAGGAGATGCTACGTGATCTTCCAAGAATCCAAGACCCAAGCAGAGGAAG
TGGTTAATGATCTTCAGGAATCGTATTTTCAACTCGAAGTTTCTCTACAATCGATCCAGGAGCAGCTAGCGGAGTCAGAGTTGCGTGCTGCAGCCCTGGA
GAAGGAACGTGACGCCACGCGAACGAACAGGAGTCGACTCACGAGACGCTGAGTGCGCTTCAAGAGGACTTCCAGGAGAAGGTTGCTGCATTGGAGACGG
AGTTGAAAGAGCTGCACGAGACCGACTCGGCTGAACAGACTGCTGCACACAAGACCATCGCGAGCGTGAAAGCTGCGGAGGCGGAGGAAGCAGAAACGTT
GACATATCTTTGTCAGGAACTCGCAGAGGCGGAAGGCTTCGTGATGGCGCTAGTCGACGAATGCTGCAAAGAAGGCGGTGAGCAAGAGAGATCTAGCGCT
GGGGGTTCTGCGCTCGGAGCATGGTGATCTGTAGCTCAAGAGCCAATTGGTGAATACTGAACTGGAGGCTACGCAATCTAATCGCAGCGCATGCTCAAGC
TGCAGAGGAGACAGTGTAGGCGCTGATAAATGAAATTACGGATGTTTTCGAAGCCACCCAAAATATGTTATCGAGCTCTGAGTCACGATTGAGCTTTCGG
ACTGCTGAATACGACACGGTGACGAAGGCGTTGAGTGAATTAAAGATTAAACACGGGGCTATGCGCACCCAAAACGACGAGCTGGGAGAACGGATCGAGA
GTTTGGCGGCTCAGAAGAACCACTTGGTCACTCAGCACTCGAGTGAGTTAGAGTCCGCTGAAGAGACGATCCGTGCGCTGAAGACGTCGGACGCTGAGGT
GAAGGAATGCTTGACATCAGTTCGGCAAGAATTAGCAGAGACGGAGATTCGTGTGGAGGATTTTACAGGAGAATTGAGCGACAAGGGAGTTGAAATCGGT
AAGCTTACCTCCGAAGCAGATGGGTTGCATGAGCGTATCCCGGCGTTGGAAGGGGAGCTACAGACGCTGCAGAGTCAGCGTAAAGCCAAGTGTGAGACGG
CAGAGGAGACCATTGCCAGTCTGAAGGAGTCGGAGGCCGAGACGATGGAGATGCTGGAGTCGATTCGAGCGAAGTGGTCCGAGACGGAGACTCACAAGAT
ATCTACCGAAGAAAAGACCGAAACCGCAAAACTAACGTTTGAACAGAACCAATATATAGCTGCTGAGTTGACGAAGGAGAAAGCTAGTCTTATTGCAAAC
ACAAGCGTCTATGAATCTACTGTGACTGACCTGGAGATAAATCTTCAAGCTGAAGCACATCACCTCTCCGACGCAGTACAGCAAATCGAAACGCAACTAC
AGCTGACGATCGATGCGCTCGAGAAGAAATTGGGGACCCGGCTCGACGAACTCAATGACAAGGAGAAGGAGGACGATACCCTTGATGAATCGTTCGATGT
TCGATATGAGAGCGACGAGGAGAACGAGATCATCGAGGACAACCGCACAAAGCTGGTGCAGCGAGCCAAGCGGGTGCTATAGCGTAGAGGTCAACAAGCC
GCGCGAGGAGCCCGGCAGCATCTTAACGCGTTTGGATGATGGTAATATAAACAGCAATTTCGAGATTCAACAGTATCAGGTTTTAAATGGTCTATTCCAA
ATGAAGCGTTGCCATGCACGGATCCAATCCAAACGTGCTTTCTGAGGGGAAGAGCGTCTCTAGACAAAACGTTTGGCCTCGAATTTCAGAAAGCTTTGTT
TCTTGTGAAAACGCTCTCACGTTGGATCGTGGAAATGGCGTAGTATCTGGCTCGAGAATGGCTTCATCAAATCCGTTGAATACCTTCTGCAGCAGTTCTT
CATCTTGAAAGCTATCCGATCCTTTGGAAATCGACTCGTTGGTAATGTTTCTTGGCGTTTACTACCTTGCAGTCTGACGGAGTCTCGTACGAGTCTAAAA
ACATCGAAGGCATCCTGCCAATATTCAAGAGTATCCGAGCCTGGTGCTCAAT