Description :
From Genome Similarity Track
Location :
Scaffold_174:35822- 39939
Transcript NameFunction/comments
Phyca_LT1534132500retrotransposon 4 protein putative
Phyca_LT153446671Mitochondrial Carrier (MC) Family putative
Phyca_LT153421871Mitochondrial Carrier (MC) Family putative

Sequence
4117 bases(100 bases per row)
tccggccttcgttctccttccactctagtgcaggaccaccagttcacgaagctccgccagtcgcggcgcatccagagccttcgtcaacagatcagctggc
atgcgctcgctttcacaatattcaggcttgagtatccccttctgagtgtaatccccgacaaacttaacgcgaacatcaatatgcttcgccttcaccgacg
cactctccccgtccatctgcctcaacgcggcctgattgtccactctgagtgacatcggccttttataggctattcctagctcctccattagctgccgaat
cccaagcagctccacggccatcaccgaggccgcgatatactccgcttccatggtggacagcgacacacccccttgtttcctgcacgtccaacttaccgca
tgtcgtccacggtaacgaacccgccagtgacggacttgcgatcccccttatcggccgcaaagtccgcatcactgaaagcgaccacgttcagggcctcctc
agagtcttcagttcccttcattcgcagcttgagcctcttggtccctcccaagtatcttaaaactcgcatggcaagcttccagtctcctagagtcgggtta
tgggtccgtcgcgtggccttgtgaaccgcgaacatgatatcaggccgtgtacatcgggccacccacgttaaactcccgacaagcgactgaaaccttctca
ctgttactgactcgtttccacccaaagctggcaatgtctcagacacatccgtttcattccattcagctcctatcggtgttctcacaccgttcgccatttc
cattccgtattcccgcaacatctcgccgatcacaacctcctggtccaagtcgtacccgtcactatcgctatacgtgatacgcatacccaggaacttactg
accgccccaagatccttcacagctagtccagtgagctcaccgaaaaacgcatctacggcgccttgttcagttccagtaactagtagatcgtctacgtata
ctccgacgacaaccaataccccttttttgagtctgcaatacacgcacatatccgtaaggctctgcttgaagcctgcatccacgagtttttgatgcagaag
cttactccatagtcgccccgcttgtttcaacccgtacagcgccttctggagctccagagccaactcatcgctatcctcagcctttagcatcttcagcacc
tcaaccgggaccgtcatcccttgaggcaagcggatgaagatatccagatccgcctctttatcggctttcacgtaggcattgggaacgtcgccgtgtttgg
ctgggacacgccacctcctcgccagtgccaatatcactttcacgctgctcatttctatcaccgcggcgaacgtgagtccgtagttcaccccaaactcctg
ctcattcccacatgccacgagccgcgccttgaagcgctcgattcctcctccggcgtctaatttcgtcttgaacacccactttgtgtgtagtaatttctcc
tttctgggcttccggaccaccctccaaactccgttcgcttcgagggcgctcagctcctcggagatcgccttgagccactcctccttgcgatcactgcgca
ttgcttcacggaagttttttgggtcagcgtccaggacgctattcaccacgccaactgccgcctcctcctgctctgcagtctcgttcacctttctggtgga
cttgcgcgccacggatcgcgtcacatggcggtctcgctgccaagtttcttcccggccgtcttctttgctccagatccagtctttcctccggctccatccc
ctgtagtgacaccagcggactctgcctgttcctcttcctcgtcgccccgtagatagagacgctgaatcttgatattctggtccttgctgggcgtttcgat
gttcttgacgtgctgagtcgtcacaacaacgcgatccttgggcaagtagaccctttatcccttcgtttcttcaacgattccaactatcatgccctgctgt
gctcgttgcgagaagttcttgttccgcgggtccctgtacactgtacacggggacccaaacaccacgatctcgcccagcgatggcgtctgttttgttaaca
ccttcagcggtgacgctcttcctgcgttcgagttgctcggcgatctattgagtatgtacgccgcgtactggacagcgtccccccagaaattcagcggtaa
tccgcatgcgaagatcatgcaccttgccatgttcatgatggtgcggtgcatgcgttctgccttcccgttgctcgcctggttattggcttcgctcctctgc
ctagccactccggtcttcttaccaaatagatccacgttctggtattctcctcctgaatctgtccgcaggacatggattctgcagtcaaatcttttctcaa
agaatgcgagaaaatgttcaaactgcttcgcgggtgcgtccttggtccgagctaggaagacccgacagtagttcgatttatgatccacaaagtttaccat
gtacctgttgttctgacgacccttcgacgtcatcgaccccttgaggtctgagcaaataacaccgccgatccggtcaatgggcgagtgctcccccgtgtct
ctacccgactgccgattcttcgattgctttccttgcgcacaggtaaggcaattgacccgcttgcggtccgtcagtctgattcctgaactcggatccctgg
ccaaacgctcgaccgcgtcgtagttcaagtgtccaaggcgacggtggaaatccaccaaggtgccgctctgcacgtcatccgacgagtcctcgtccgtgcc
ggttgcttcgtctgccagagccgccatgatcacttctgctggaggtcgcaacctcccctgtaccgttccaggtaccacgagtacatttctgcgcagctcg
acgtcgaaagcaacctttccgccgtctctggcggcaaccacacgtcgcccatccctgcgcgccagcacgaaacccttccggtccagctgcccgtacgaga
tcaggttgtgtatcacacccttcgcgtagtaaacttcagttaacttgacggtctgcactgcgccgcacgcagtgacttgcaacgtcacgctgcccttctt
agtgatgcggagcgcatccccgttcggttgaacgcactggtctgcacaatcttccacatcctccagacacgatgcatcgttgaccagatgcctgctggac
cccgggtctaggatccaaaaatcttctgactcgtctgagtcgccctcactaagggccaatgtcatgtccggcttcctacctcccgcctgagcgcgctcag
gacacatagggcgtatgtgcccgatcttaccgcattcatagcatttccgggtctccttctgcttctcacccacggcactcaccacctccctaccgaggtt
tttcccttttccgctctcaagctcccaggcttgggcgaagtgcgcgagctcctcggcgtgcaccaggtagtccgttcgggagccgtccactttcgccatc
aagaccattctgagatctgccgatgcgtactggacgatgttatttaaaaccaggtactctgcactcccaccactagcctctgacacagccaccaaataca
tgtagtgctccggccacgtccttttcggatccttgggtgcggtgaaaagcttcaccgcctgcgccggagtgatgtttgtcttgaacgtctccaacatcct
ctccatgacgtatcctagcgaaggatactggccccaccacgattctatctgcttgctgaaatatctctctgccgtgcctgacaagtagtggccttacagg
tccaccttgacgtcttctggccaaagaaatccacaagctgactgggcgatgttcacttgccgttcaaaacgcttgccccactcgaggaaccccgatccta
accccacatagagctccttaccatcgaatgggcggatggcgagcttcttctgtctcgcgtccgggtagcggactgctccctgctgttgctggattcccgc
aggaccagcctgtgccggtggtggctgttggggagctggagctgcgtgtgcctgagcgtgctgtactgcaagagcctgcgcggcacgttcggccgctgca
cgatctcgctcctgctg