Description :
From Genome Similarity Track
Location :
Scaffold_50:358080- 360913
Sequence
2833 bases(100 bases per row)
CCCGTCACAAGGAACCTACCTCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCACACATG
GTGCGTCGTACACCATCGATCTGCCAAAGTCAATGACGACGCACCCGACGCTCTATGTTGGACACTTAAGCGGGACTTTGACCCGCAGGGGGTTGCTGAC
TCGCAGACCCCCCTTGACCCAGCTTTTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGATCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAG
GTTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGAACCCCGGCGCATACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGT
GTGCCGCAGGGGGCTCCGGACGTGGAAGCAGAGCTTCGATCCGTCGGATCATGTGAAAGGCCTCTACAGATTGGGACGAAGAGACCCGGCAATCCACCAC
AGCGCACTGTCGCGACCTCTCCGTTTTACAGTCCAAGTCGGCCCAGAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGAGCGGCAGCATCACCGCCATT
CCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGTTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAG
TGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTAGACCGAAATGATGAAGTCCACTTCCACGTGGAGCGGATCCTC
CAGGAGCAACGGCGTCACGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGAAGCCGATTGAACGGCTCCTGATTG
ACTGCCCGAAGGCTGTCACAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATA
CCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGAT
CACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTC
CTCACAAGAACTCCATGTGGGACAGCTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTC
GTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTT
CATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATA
CCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGG
TCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGG
AGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAG
ACCCTCGGCAAGCGGCAAGCGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGC
ACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGC
CCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTGCGAACCGAGGGTTCGGACGATTGTCTGAAGA
CGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGT
GCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCA
TGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTC
GATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTAC
GTAGCACTAAGTGTACCCTGGTTACATAAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTC
ATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTT
ACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCAGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTC
CTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA