Description :
From Genome Similarity Track
Location :
Scaffold_14:358062- 360542
Transcript NameFunction/comments
Phyca_LT1534505586SCP-like extracellular protein
Phyca_LT1534505593calcineurin-like phosphoesterase, putative

Sequence
2480 bases(100 bases per row)
acaggcactgatggcttcactatgcatgcgggccttggtcatcgggctccggacgacgatgagatcgaaaacaattacttcggggaacagaagctcatgg
agggcgccctaatcaaattgggggactacgcgcactaccggtactttcagcttttccgcagtggacgtttctgctactacgaactgccaatgccagcagt
gacagccgacggagctcgtagaattcacctcacgtcgaagcacctgcgaggcttcatgacgctccgtgcgtcaggtcagaccaaaagtctagccaacaac
gaagaagaatacgaggccgatctcctcaaacgcggactcgtgttcaaccgtaagaagctcgagatgcaactcacggggtactcgcccttgggccaattac
tgtcctggaaacttcgagccagcagggacgccgtgtatttgaagtgggaacgtgcatttcgcattgctcttcgacctatctgggtgcaaaacgcgatgca
ctgtatggtgtgcaagaaggacttcacctttttcatccgcccacaccactgccggtatggtaaagtatttagtttctgtttcatttcaacatttgacgct
gatatttgtcttttattgcagcaaatgtggaacgtgtatgtgtgacgaatgcaccgtgatggcgccccggttaccattgcaaggctactacgatgaagtg
cgtatctgtcgagactgttcaccgatcagcagtcagcttttgtcactaaaaaagggtacacgcatcctggtgtacggtgttttaccagggctcgtagtgg
acgtgagtttacccgaaggtgttgatgggaggggaactgtaagtgtgcagctggtggaatacaataacgaggtacgaagttatgctctggagcgcgtgga
gctctattcagaagcggtgctatcggcaaaccggatcaagaatgcgattcgaaggcacctggcatacttaatctttcgagcacgtctcaatttcagcacg
tggaacctactggaaacgatgcaagagcaacaaacgatgcaaatgatgcggttcgccaagaagtcgatgagtattaacgacctcccctcgatgatgccac
ttctggactcacgtcgtacacttgacgatgccgttctggaaaaggaacaagccaagctttctctcgctcattaccatggagtccgggtactgtttccctt
gcgcctgaacacagtgaagaggctgatcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnntcctgtgttcgtacggcgtatcttggacgaatcagcgaaattgttccaaacacagcacaaatctcctatga
actctgtcgacattcccccgggagtgaaaatggttgtagtgggcgatctacacggacagctcgaggatttactgacgattatggagaagaacggggtccc
gagcaacaaaatctggtatctcttcaacggagactttgtggatcgaggagcgcacggtgttgaaatcatgctgttactacttgcgttcaagcttttgtat
cctgagtgtgtgtttctaaatcgtggcaatcatgaagagcgcatgatcaacgagatcttcgggtttcaggatgaagtttactccaaatacggaattgaaa
atgacgccagtgcaggttggggaggactaagcacgtccatcaactactcagctaccaagctgttccagatgttcgagactgttttcaacttgttcccggt
ctttgccttggttaatcggcgcgtcttcgtcgtccacggaggcttgagcaaccacgagaacgtcaccatcgcagagctacaacagctagatcatcgtggg
gaaccttttttacatggcaccagtcgcgaggatgagctgctgacgcatcttttgtggagtgatccgtgtgacgaagacggatggaaaccttctagcagag
gtgcgggagtggaatttggtccagacatcacgaaggagttctgtaagcggaacgacatcagcctcatcatccggtcgcacgagtgtagagaagaagggtt
tgatatcgtccacgacggactccttctcacagtcttctcggcgtccaactactgtggctctcagaccaataagggggcgtgcgtgttgctggaacggggc
gaaaacaatgacattcagccacgtgtggtgcaattttcatcgcaaccgctccaaaagttacaagctgcagggagaaacgagtggagaaagaaagctcgca
atttagaacgccaaacgctggagtcgatcctgaagttcatctgtgagaatcaaaacgcgttaatgctcgcttttcagcaggcggacacgacggggtgtgg
acgagtgtcgaagattgagtggaagacagtgctgcaacgggtgctgggaatccaagctaactttctctcgtatttccacc