Description :
From Genome Similarity Track
Location :
Scaffold_2204:358- 2923
Sequence
2565 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCCCATGATAGCACTTGTAATCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGTATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCATGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTTTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTGTCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTTCGTGCGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGG
CGGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGA
CCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCCGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGG
GCCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTAC
TGGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGACAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAG
CCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCA
CCCTGGAAGGGAGTCAGCTGTATGCTGAACTGGAAGTGCCAACGAGAGAAACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGT
CTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCA
TGGCTGGAACGTCATGAGACATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGCCATGAACCCACCT
CTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGAAATTGGTATGTCCGAAATTGTTAGCAACGAGGT
TGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACAAGCGC
GGAGTGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGC
GTGGCCCAGGAGATGCAGGTGAAGTGACACCTGGCTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTC
TTCGAGAAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGA
AGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCG
TGAGCGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGGCGAGATGTCCATTGCCGAGTT
CGGCGAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATTCGTCGTGGACGACGCGGTCCTAGAG
GACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTAGCTGGTGGTGAAGGAGTATGGAGACGTTGTCT
CGAAAGACCCACCGACGGGTCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCA