Description :
From Genome Similarity Track
Location :
Scaffold_747:358- 2417
Sequence
2059 bases(100 bases per row)
CTCGAGCCTTGTTTTGCTGCGTTTTGCTCTTCCTTTGAGCTTTTCAAGGAAGCTGGCATTGCATGTAGCTGGATAGTCGATCCACAGCGTGCATACATGT
ATCGTTCATTCCAAAGGTATTGATATCCTAATTTCTTTAATTAAATCAAGACAGCTTCACACTTCGACACTTTCAGGTTTCCGTAATTACCATACTGACA
TCTAGATGTTTACGAGCTTGCTAATGTCTACAAGTTGATTGAGCGCACAACGCTTTGGCGGGTTCCAGACATTACATCGTCTTCGGGCCTCAAATTGCGC
TGATTCATGGTCTCATGCTCCAGCTTGTACAAGTGTAAGCTCATGCGCACTTTGCCTTTTGACGAGCACAGGTTTTGCTGAAGGTAAAATCGATGATACT
TCTCCCAGCAGGTCCACGTTTGCTCTGGGCACAAGTATGACTTGGGGCGATTGACACGTGCTGACAAAGACAAACGTTGTGGAGAACGCAGAAGTCGGTC
ACCTCCGTCGCGTATCTGTCCTCCCACCTACATTAAACACAATGTCGCCGCTCCCGATTAGATTCTGGTATAACGTTTTCGAGACAAACGCGGAGCAACG
CTGATTGGGACTGCCAAGTCCTCCGTCGGCATCGTGACTGCCTGCAACCCATACTGCACTTGATGGTGACATGTCTTCGTCCACAGTGGAAGGCGCATCC
AGCGAATTTACGTTCGTGTAAAACATGGGTCGCTCGCGGGGGGGGGGCTCTTTCCACTTTCCATACAGAGTCACGGTAATTGGTGACTCCGAGTGCCAAG
TTGCGAGTGAAGTACGCATTGAACCGGCCGACATGCACGAGCGCTAACCCGAGCTTTTTAAACCACTTCTTGAGGGAATGCTCATCCGCCAAAGAAAAGC
GCCCTCGAACTTGGTCGAGCCGGTCAACACCCTGCACGCTCGTGTTATATTCTTTGACGCATGTCGAGCGTTGAAAGGTCGCTATTCGGGACGGACTTGG
CGAGTCATCGTAGTCACCGTTGACGCGTCTGCATTAGAGGTAACAGTAGCGATAGAGCTATCGTACCACGAGGCCGCCATAGTATTGCGATCAGCAAAAA
CGGCTTGGCGAGCGATTCCGCGAACGCAATTCTTCTTATCGAGGACATAAAGTGTGCACTTGACTTTCGAGCTGTTCCCCTTGTATACAACCCTTTAAGC
CGCAATGCATCAAGTAGCTGCACGGAGGTGTAGTAGCTGTCCGAGTTGACAATGCGGCCAGTGCCGTACAGCGGTCGAGCTACTTCCAGTACACACTGTC
CGATTGACGAAGATACTGCAAGCTCATCGCTCAAGGCTAGGGCTTCTGCTTCCGTCGTCACTCCAGCTAACCGTTCGGTATCGTCATTTGGCAGTGAAGC
CGAAAGTTCAACGATATCCACGTCGTAGAAAAACAGAGCATGTAGATGCGAAATGATATTATCCGGTAGGCTTCATAGGATTGTACACAATGAGTGGCTT
GCCATACTTGGACCGGCACGCGACGCTTGATTCGTCCAAAGCAACATTTCGCCCCACCTCCACGTACTTGGGGTCAGTCGTCTTAAGAAGATTGAGGAGA
GGCCTGATTCTTGTTGCCTGGTCACGATTGCCGCTGCTAGCCTCAATACACTAGAAGCTAAACGCTTTCTGGAGCTGTTTGAGCCGACGGAGAGGCATGA
CCGCGTCAAAACTGACTGATTTTCCGCTAAAAAATGTGTCTTCCACCTGCCCCCCCCCAGTAGTTGCTGTACTCCCCCTTATCCACTAGTTCCATGTAGA
ACAGCGCACCGAAGAATACCAAGATCTCGTCCAGCGTAAATGGTTGTGTGAGAGCGATGCCATGCGCACCGGCAAGCGGTTTGTTTCACTAACTACTTGC
TGCCAAAATGAGATAGCGATACAGGCAAAGAAACGCGCCGAAGCAGAGTGCTCGGATATATGCTTGAGCTGGGGTAGAAGTCGCGTCGTGGTGGTGCCGT
CAGCGTCCCGATATAAGTCTACCGGTACCTTACTCTAAGCTCCAGGATCGAGTCTCATA