Description :
From Genome Similarity Track
Location :
scaffold_11:357958- 361418
Sequence
3460 bases(100 bases per row)
ccgtcaaaagcgtccTGATACTCGGTGCCCCACCACctttccgcatccttcttaagaagattcCACAACGGCCGTGCCTTTTCGGTGTATTTGTGCATGA
AGTTGGCGAGGTCAAGCCacctgcgcaagtccttttggctcTTTGGAACCAGCCGTTCCtcatggccttgaccttagcgcaTTCCGCTCAaaagccacgc
tttccaatgaagcatcctAAAAATGGAAgttcttcggcgccgaagatcacttgtctgcattagcatacagcttatttgtgcgcatgcactcgagcaccga
tctcaaatggacgatgtggttttcgtgGAAAAGATGtcatcgaagtatgtctatgCATATGCCCAGTGGAgcctaaacaattgcgtcacaagacgattaa
atgttactggtgcatttgacagcccttagaGCATAACCAGCCGCTCCcacagcatcccgctcggagtactcaccgctgtcagtggaATATCTTTTGctct
tttgtgcaattggtAGAaatcatcgaccaagtcgactgCGCTGTAATTTGCACAGCCAACtgtgttgttctggagaacatttttttatgaatTAGCGTCT
GTGTCGAAATGGTAACAgtatttagcttattataagagggaacgatacgccacttgccgttcggcttccggacacaaaacgtgggtgacaAATGGGGTGA
CTTGCTcttacgcaccattcctgcatcgtgctttgtacggaaaaatgcgtcaatgacgtcgcactactacttgggcaggggccattggagtgttacgcag
tatttggttcccgaaaccaggtcaatctcatgacacacacctcggtgcggaggtaggaccgatggcgggtctttggagacgccgtcttggaattccttta
ccaaaggataatacggatccgaagGATCCTTCAAGATCGatgattcacttcgtgcgattatcactctcttggtgtcttccaggacagcttcatccataaG
CGACAGAAGATAGCGcaaagctatatacccttgtcatcggtatgacgggagaagatgacggcgacgtcagTCTCGAGGCTATTTTCGCGGTAGATGCTCG
ttttgagctgaacgagatgtccctcgaaGTTTTTAGCGGTGCTTGAAAGTAGGCAATTTAGCAGATGTTGTAAGACCGAACAAGGCAATTTATACGtcac
ggtagacacaccctgggtcagggtcaacGCTCTGCGTCTTAAAGATAATATACGGCATCACCGTCTTCTCTTTATCGAGGATTtatgtctcatcgagacc
agtaggAAAaggcactcggcgtcgtccatttcctgctccatcggagccttgatgctagtaacaacatccgacgaaggaCTGCTATTTCTACActcttcgt
ccagtagataacgtgccacgcCACGCACATCACAAGGGGCTCGGCTTTGATgcttcggacctcgtccgaccatgccattctttgcacgaagcaactgctt
cgtaacgtgagcattgctcagtgggctacgtgacactccacgtttagcccgcgagccacgctcaagAATCTTgtaacacctttggtgtctgacaactcgg
atactccgatatccagcacattgaccggcCTGGTCTAGTGcacgcgccaatagcgcttctactTCTTaccagaggtgggttcatgactcaccaaagctcc
actaggaggcgtgcgcgtagcgcccaaggtctttgacctccaatcaatctatggctcacggtgtttcaaccatgccgtTCTAAGGATAAGGCcatacctt
gcattcaagtctaagactagacagcattccacgctatcaaagtcaagaaacttgactccgaggtccacagggaccctcgctacagtgacacaagtcccca
tctttaagcgaacagtgacggtgttacTCAACCGcacttccagcgcctcagtatGCAACAAACTTGTTTTTCGATTGTGGTGCGTCGATTATAATTGCCC
GAagcaccagaatcgataaggattttccatggcttatcaaagcccttcacggtcgcttttacgatctgcaagctcggcttgcacacacgttccgtgttca
agaacacgcagctcttcggggctgcgCCTTGCggtcctctacctctttgacgCTCAGCAATACTAAGTTCGCCTCCAGTAGGcagccccgcgcctactgg
gtgttctcgTTTCTTCGCGTCAAACCAGAccggttagaagcgggacgtcggttcgacgaacaTTGACACGCATTGCGCAAGAGACAACCCgcccgaaggt
gacgggtgtgtccacaaacaaaacactgtGTGATGTCTACATGCTGTTCAACAGCTCAAGCTCTCTCTCCTCCTTCTCAggatagctgagatccattggc
tcaggcccgctcgacgagctatgaGGGTGTaaatttcaaccaagtcgtgccgacttaaagctgaatttggcattcaattacacattctgcttcttcaaaa
gaagatgggTGCACactgaagacttccattctggccacgccagtgcggagacttaccataaagacggtcactgcgaccgcttcagggagaggatcggctg
ccatcttgGCAATGatagtacgcaactcttggacagagtccacctactccttcttgccctgtcgggcagcatggaaacgcgatctcacgcgatatgcctg
gttgggcggcaagaaaCTCATGAGAgcagcagcttcagctccgttcaGTAGAGAAATGCCGCTTTGACCAAAGTGCTGCCCgacagtgcccattctcgtg
ctcgaccCCCAAGctcggagatagctagcgcgacgcgctgttgatctgtctggagcatggcgggcGCCATGGCTATCTCAATTTTTCTCactcagagcag
gagattttctccacTCTTTCCCTCGAAagtcttaacactcaccatgagcggcttgggtcggaGGGAGTCATCCTTCGCCGACATCTTATGCTACAGGTGG
TCTAGCAGAGTATTTTCAAAACTTGATATTCTatccatccttgccctcgaaggtcttatcactcaccatgagcggcctgggtcgaagGGGAGGGCATCCG
TTGCCGACAGTCCTGTCGTGGAagaagtcgacgccgacatcttctgctacaAATGCTCTAGCAAagattttcatagcttgtaaacgtctctaggcgcgcg
ccgATCGCTTCTGGTTCTTAAGAAGCGAGGTGATGCACGTCCTCAGGGCAAGCATGGATATCAGCTTCTTAACTCCCCCCTGCATGTCCTGGGACAGATA
CGAGAGCGGCTTCATTCTCACAGAGAGTTactcgtaacgactcagggttagattgactacaagtatcaccaaatgcagcggggctgccgtagctctttcg
cttagagaaagcttagtTTAGGTCGacgaccttcgttctgtaCCTAGAATTTgaatgagt