Description :
From Genome Similarity Track
Location :
Scaffold_366:35783- 37018
Transcript NameFunction/comments
Phyta_totarag7599hypothetical protein PHYSODRAFT_334010

Sequence
1235 bases(100 bases per row)
AACAACTGGTCGAGCAGTGTACCAACTTTGAGCTTGCGACTAAGAGTAACATCTCGCTTGATGGTAGCGTTGTAGGTCTCTCACGGATTGCTTGTGGTGG
CAAAACCACTGGGTGTATGGAAGCGCTGCCAGCGCCACACCCTCTGGTTAAGCCACCGTCAAGAAGTAAGACGAAAACCGGACCAACTGCGGGTACAGCG
CCCACCGCTTCTGTACCTCTGCCAACTTCACGAAAAACTCCTCCTCGCTCACAGTATCGAGTAGCTCGTGCAGGTCTGTCATGACAGAGGTAGCCACACT
TTGAGTAAACGACCTTATCTTCTCGTAGACCTTCTTTGCCACGTGAAAATAGCACATGAGGAAGCTCAAACCGGAGTCCGCTCCGAGAACTTCATGTACC
GCATTCCACTggtcagcgtcagcgtcaccCATTACAAAGCGAACGCGAAGCGGCTTGCCTGTAACGGTAGCAAAGCTCGCTTCAATAGTTTCAGCACCTC
CGTGAattgtggctgctgctgctgcgagacAATGAACACAGCAAGTGGGTGAAATCGCCGCGCACGATCCGAAAgcccgacgacgatgacagGATACCCA
GCTTGCGTCAATTTGTACGTTGCATCGAGGTGGAGGATGAAGGTGTTGGGGTCTCGGTCAGCCTGTCGCAATAGCTTCTTCGTACTCACACCAATAACGA
ACGGGTTGCTGTCGCTTCCGTTTCCCACCACTGGCTTgccttcatcgtcttggCGGCTGCAGAGTGTAAACGCAGCCGTTTCCTCTTCCTCACCCGTGAA
CATAGTTTCTCGAACCTTAGCAAGAACCACGTCGAGAAGAtctgtaacggggttacacgtacaagtggctacatcattTGTAatctaacagaagtggctt
ctgttagaagttagttacctccttccttggtgtgaggcacaccaatggctacatttaggcggacgactggtccgcatacatttagagatctcattggtag
aaagcagcatctttctacccaattagaatcataggattctgccgaccacccgtcgacaaacccctattacatagtatgacttttaggaggtaacttcact
accaataagcaaacaaaatacagttctcaatttcacctaaagtgttaattacagtctttaatctagctttaattatacttgtgagacgcaagtataatag
agttaagtctaagaaacctacgcttcctcatacac