Description :
From Genome Similarity Track
Location :
Scaffold_5:357798- 361135
Transcript NameFunction/comments
Aphas_H257_02284Endo-1,4-beta-xylanase A precursor
Aphas_H257_02285dipeptidyl aminopeptidase/acylaminoacyl peptidase

Sequence
3337 bases(100 bases per row)
CTGCTTCTGGCCACTTAATCAACAAGTGCTGCCTTATGCCAAGGCCCACTGCCAACTCTTTCTTTGGTCTGTGTGGTGTGATTAAATGCGATTACTTTGT
GTGTGTCGTTTGAATGAGCTTATGCTAGCTTCATCAATACTAGTTGAAACGTTACCGTAAAACACGAGTCTACTAGATTTCTCTATGTGGTGGCATTTAC
GAAATATGCTATCAAAGCGTGGCATTCCGGCCATTTTGCCAAGTGTATCTGGCCCCTACGGACATGGAGACTACATACATGTATACACCAAGTCATTTCA
CAGCGACGAGGTGTTTGGACTCTACGGGCGACTCGCACTGCATCCTGCGGTGGTTTTACATTGCAGGCAACAACCCGAGCTTGGATCCGTTGGACCGGCA
ATTGATTTGGAACTGCGCGGATATTTACATAGTTAAGTAGCACAAACTTCAGCGACTCGCAGCCGACGCTTCGCCCTGCCACTCCAGTGACGACTGCTAC
AGTACTACCACCCTGGCCCCAGTGACCCCTCGTCCAGTGACCACTCCAACATCAACCAGAAAGACGCCAGTCCTTTCGTCCGCCACCGCGGTGCCGACCA
CTGCGGACCCCAGCAACAAGTGCTGCAACGTACACCAACACTTGCTAACCTTACTGGCCGTTGACCCAACACTTGCTGCAGTACAGCAAGGGCGACTGTG
CCCTGTTTGGGTCGTTCGTGTGGTGCCCGTAACGATTATGGGAATATGTCAGTTCTAATTGTATGTCTCCTGGTGAAGATCACACCAACTATGGGACTTT
GCCGTGGAATAGAATCGAATGAATTTCACAAATGCCATTTGCGATTGTCCTAGCCAATGAGATGTTCACTAACGAAACATTTCTACCAATCATCAATTAG
TATAGTTTGGCCAAGCCAAAATGTTGACCTGCATATGCTTATTGCATACATTACATAAGCTTAAAATCTGACGCATACATACACTAGTATGTCAAGTCGA
TTCTCGAATCAGCTGAATCCGTTCATGGAAACTCGACGATGGACTGGGTCGGCTGCCGACTACGCACGGGCGGCGTCGCTGCCAAACCTCCTCCAAGGCA
AGGTGCTCAATGAGCATGTAGAGCCTCAGTGGAGTTCAGACGGCACGCGGCTGTGGTATTTGCGGCAGGTTGCGTTGGATGGCCGCAACGAAGTGTGCGT
CGTCGACGTGCATACTGGCGAGTCGCTCGTGGACAACGATCGCTTGAAGGCAGCCATGGGGAACGTCTTGGCCGATGAATTCCCATCCCTGGAGCCTCGG
GAGATTCGATTCCGCAGCGTGGCGTTGGTCGACAACGCTCCACGCGTCGTTCGTGTCCGCGTGGCAGTGCCCTCACCCTTACCTCCAGGTACCGCGCAAG
TCACGACCGTGCTAGGTAGCCTCTTCCTGACATCAACGAATTGACACTCGTGTTTCGTTGCATCGAGTAGCGCCACAGTCTTGGTTCCAAGTCGATTTAG
AGCGTTATGCCGTGCAAGTCCAGGACACGCCTTACAACGATCCGTCTAATCATCATCTTGACGAGATGGCTTTGAAACCTCGTCGCATGGTGACGCAGCA
CACTGGCAACGAGACGCATGTGCAGTTTACCAACGGTTGTGCGTTCCATCTACTGGTGTATTGGGTCGATGGCGACGGTAGGCCACCACTGCTCATAACC
AACAACACATCATCACATATATATCCCAGGCCGCCAGCATCAATACCACGACGTGGCACCCGGAGCGTCCGTCGTTCAACAAACGTACGCAGGCCACGTT
TGGCACTTGACACACGAAACTGAGTCGATGACGTGGCACCGTGCAGTGGAAGGGCCCCATCAAGTGACCGTTCTCGGCATCGACTTGACCGAACTGGTGC
CATGGACACTGCCCGACAAGCCGGACCAAGATGCATCTGATGTAGCTGATGCTGCTGATGCTGCTACTGATAATGATGATTTATCTGCTGGGTTCAACGT
TGTACATGGAGGCATCCAGCTCACGTTCGATGGCACCCCGGAGGCACACTATGACCATGTGACGGTGTCGCCCAATGGCGAGTACATTGCGTGCTTGCTT
GTGGTCGAACCAGCGTCGGTATATATATATATGCTTTTCGTTCTATTTTTGTTTGCCAACATATTGTTTGGTTCGATGTATTGTGAATTCGTTCTAAACA
ACCTTGCAAAATTCGCCTGGTCGAATTAGTATTGAATCACGGTGGAGTTGTGATTGGTTGTTTATACCGTGTAGCGTATATAGGTGTAGGTTTAGATAAC
CATATAGATTTGGACTCCTCTGTAAAATTATATAATCCTCTGTATTATTACACTTGATTATTGTATGCATATGGTACTCGACACTATCCGTATCCGGATA
CTTGCCATACGTTACACGGTACTTGTCCTTTTTTCTGCAAGAGCCAATCAAATCCACGCAAAAATGGATAAGCCAATAGCGTCGATTCGTGATTCGATTC
GGCTCGATGCGACGGGGTCTGGAAATTCGTATCGGATCCACAATATATATAAATATATATATATATATTCGTTCTTTTTTTGCAAACGAATTTTTTTTGG
TTTAGCTTTTTCAGGTCACACATGATGCAATTTTCGAATATATATATTGTATTTTGTGTTTTATATATTTGGCGCTTCCTAAATGTTACTAATGTTTAAT
TTTTGCATTTTCATACACGAATAATAAATACATTAGGCCTCGACATACACACTGACGTTGGTGGAACATTGCGGGGCACCAAAGCCGACCGTTCAAACAC
ACAAGTACCCCCAGCCAGGCGACGACATGCGGATCTTCCGCCCGTTTGTGGTCCACATTGCCGTACGTACGAAATGATATGTCACGATGACGTGATACTG
AATTTTCACTCTGAGAAATTCGACTTTTTGGGGCCGATTTGCCAAAAATCGACCGATCGATCGATACTTTGTACTAAATTTTAAATGTACAAAGTTGCCC
GGTGGGGATTGTAATCACATTTAATAATGTGATACAATTACATGCGGAATGCTTACAATTGATTGGCTCACAATGCGTCTTCAGTTTATGTATTTGGTTG
TGTTGTCGATTCTCTATTCTGTATACAGTATTGTAGTCGAATCATCACTGAATATATAAAATGGCACATGGAAATGAAATATCACACTATTTTCAGTCAT
TTACGAATTAGACCTTGATGGTGGTTTCCTGCCATCGGATTGGCTCAATACGTTTGCCGATTCTACTTCTTAGGTTCCTTTATATTTAGTTGTGTGTCGT
CGATTTTTACCATTCTCCACGTTCTCGCCTTACAGTT