Description :
From Genome Similarity Track
Location :
contig_7:35777- 38042
Transcript NameFunction/comments
g2459.t1hypothetical protein

Sequence
2265 bases(100 bases per row)
ATGCGTACTCGTGAGGCAGCACGTCAGAATCGTACGATAGACAACAGAAGAGGGTGCTTCTCTCCTTTTCTGGGATGTACCAGTCTGGAGCAGAGACTCG
CACCAGCTCTCGCTCGGCTTCTTCCGTGACAAGGTGCTTATACGAAGCATGCCACTTCCTCACGTCGAAGTCGGTGCTCAGGATATCTTTTAGCGGAGCG
TGTAGTTGATCCACCTGAAAGTTTTCTTTGGCTACCAAGCCACAAAGAGAGAAAACCTTCTTGACGTCGGCTGCCGATTTGGAGCTCCCAATCAAGGGTC
CACTGGGCCACAGTGTCGGAACGGAGAACCTTGGGTTGCCGGCTTTGGTCTGGAGGCTCTTGTCTTGGAGGGCCAAGCTGATGTACTCATCGAACTTTGA
CCGATAGAATTCCTGGTAGCTCCTGTTGACAGCGACGTCCAGTGGCTGGAGCAGGTTGGTGAGATTGGGTGGGGCCAAGAGAACGAAGACGTTATAGCGT
TCCAGTCGCTTTGAGTCCGCCAGTTTCACGTGGCATCCATAGGAATCAATCAGATAGAGGACGGGCTCTCGGTAGAGCTGCGTCTCCTTCCTTCCGCAAA
CCACTGTCTGTGCATGAGCCAGGAGGAGGTCTTCATTCCACATGCCGGTCTTGTTGACATCCACAAGAACACCAGCAGGACACTTGGGCTTGTTTTTCAG
CTTGGAGAAGAGCAGGTGTGGCGTCAGAAACTCGCCCTCCACTGTGGTAGTAAACGTCGCTGTGAAACACTTGTGGCTTGAGCCGCCCTTTCGCAGCAGA
ACCTCACGAACGCCGCGGGTAGTTATCGTTGATTTGGGCTCAGTCTCGAAGTAGCGAGGGACCTGGTTCATATTGATGATGTTTTTGGGCTTGATTCCAT
GCTTGGCGATGAGGTGTTGGGCTTGCTGGATGAAACGCTGACAAACGTCAGGTGCATCAGCTGGTAGAGTCCGGGTTGTTGTCTGTCTGCGTGACACCAA
GTTCCGACGTCTCTTGAATCTCGCTAACCAATCCGACGAGGCCTCGAAGCCAGCTGCATTGCCGCCGTGGAGTTCGCGATAGATGTTGACCGCATGCAGC
CGAATGTACGAGTCTTTCACACGCAGGCCTTTGCTGTTCCGGTGGGTGACCCGCTCGTAAAGCAACTCCTCCATGTCACTGTGAGCTGGTCGTCGCCCAC
CACCGTTGAGGCGTCGGGCCGTTCGTGTGGTAATTCGTCGATCGCGCGAAGCCTTCTCCAGCTCAATTCGTTTCGCCTACCAGCCTCGAATGGTGCTAGA
CAAAACACCGTGTTGACGATCAAGAGCATGAAAACCCTTCCCTTGAACACCGGGCTCATATTCATCAAGAATTGAGAGCTTCTCTGTTATTGTGAAGCTG
CGTCGTGAGCTGGGCATCGTGCACTGGAAAGCTTCTGGTGAAGGTGTTGCTGGTAACGAGTGTTTTTGTTAATGAGCTTATGAGTACATGCAACGTCGAT
GGCCACCGGTAGAGAAGAATGGTTGGAGAGTAGGTGGTCTAGCCATTTGTTAGAGTCAACCTAGAAGCCTTGGTTCAGACCTCGTTTAAAAGAACCCTTT
CCTCTGTGGGCGTCCTTCTATTCCGATACGTGTTGTGATCGGGGCTTTATATTGATTTTGAGCACATCGATTTTTTATTATTACGCCTAGACACTCTATG
CGGGGTAAGACGGTAGGTTAGGTTAAAACCCTAAGGAACAGTGGACCACACTTCGACTGAGATGCCAATTTTGATCCTGCCCGATTATTGTTTCAGGACC
AACTCGTTCTCAGCGTTTTTTTTTTTGCTTGAGACTCTGTGTGTTTGGTAGTGGTCAAAACGTGTTTGATTTTACCCAGAAAACTATTTGGTTTTAACCC
GCAAACCAATAAAACGATATTTCGGTGGCGAATTGTCATCAAACAACATTCACGAAACATTCAATTCAGTCGACTTTCCAGCAACATTCTTTCTGAGCAT
TAAACCGGAAAACAAAAAATACAAAACTCCGAACTGCGAAATCAAGTGTGCCCGCGAACCAATAAATTGATGACATGCAACGAAAGCTTGTCAGAGCGAG
AAATAGATGTGTGAGATGACTTTGGCAGTTCAATATACCCTTCGCGCTACTTAGTCGTGCCCAAATATTGAGGTCACAACAGCTAACCAAAAGCTCAGAT
TTCTTCACGTAAACCATAATTAGTCAGGGGTCGACTAAATAACGTGAAGGGTGTACTGTGCACCT