Description :
From Genome Similarity Track
Location :
Scaffold_247:35767- 36785
Transcript NameFunction/comments
Phypl_g5910hypothetical protein

Sequence
1018 bases(100 bases per row)
CGTTGTAGCCCGACAGAGTTCCGCTGTCCGTCAACACGTTCAGCTCACAGTCGCGACCCAGACTCGACTTGCAGTCGCTCGCAGCCGTCGGCACGAAGAA
AttgccgtcctcgtcgtccaggttgGGTGTCGTCACCGCGTCGAAGTAGTTGccctccaccagcacgtaggcgctggccgcgacGTCGAAGGCATGGCCC
GAGTTGTCGTCGAAGTAGTTGTTGGCGGCATGGACCACGACGCTCTGGTCGGCCGTGCCGCCGATCTTGGGCGAGCGGCCCGACGTCTCGTGGATGTAGT
TGTTGACGAGGCTGATCTGCGTCGTTTCGCCATACAACAAGAACCCCCAGTAGTGGCGTCCGTCGCACGATGCCGAGTACTCGGTGTTGCCGTCGAAGTC
AGAGTTGCTGATGGTGAGGCCCATAGCGCCCGAGAAGTTGACGACGACCATCTGCCGGCCGATGCTGGAGATCTTGACGTGGTCGACCCAGATACCGGAT
GGCGCCGTGTCGTCCGCGCCGCGGATGGTgatggcgtcgccgcccCAGACGAGGTGCGGGTTGAGCTCCGTGATGTATATGTTCTGCACGATGACGTTGC
TGCCCTCGATGAGCAGGCCCTTGCCGTACAGCACGCCGGACGTGCCATCTCCGACCAGGGTTTTGTTGTTGGAGACGACTAGCGGgttcttggcggcgtt
gtCGTAGGTCACCTCGACCGCGAAGCCGTCGCTGTCACAGCCGCCGGTTTGGGACATGGCGGTGTCATCGTCCATGAGGATGACGTCCTGGGACTTGTAT
CCGTTGTTCTCGGCGATGCATTCCTGGTTGAAAGTGGGCCTGCATCCCGTCTCGGTGGTGGATTCCTCGGTGCCGGAGAAGTTGAAgctctgctggagca
caaTGACTCTCGGTTCATCGTCACTGAGATAGGTGGACAGTTCGTCGATGGTGGTGGGGTAGACCGGctcgatgctgccgccgccagtggTTCCCGCAGC
GAATCCGGGAGCGGATCC