Description :
From Genome Similarity Track
Location :
Scaffold_8:357629- 377607
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05738hypothetical protein
Phypa_INRA-310PPTG_05739hypothetical protein
Phypa_INRA-310PPTG_05740hypothetical protein
Phypa_INRA-310PPTG_05741hypothetical protein
Phypa_INRA-310PPTG_05742protein kinase
Phypa_INRA-310PPTG_05743transmembrane protein
Phypa_INRA-310PPTG_05744hypothetical protein
Phypa_INRA-310PPTG_05745hypothetical protein
Phypa_INRA-310PPTG_05746ribosomal protein S6 kinase
Phypa_INRA-310PPTG_05747hypothetical protein

Sequence
19978 bases(100 bases per row)
ATCCAGCGCTTTTTGGGCGTCAGTTTGCGCCCAAATGGAGCCCTGTTGCCCCCTGCGACGGCCGTCACCTTAAGCTTCTTGCCAGTCTTGACCTTGACGC
CGGAGAGCTTGTTCTTCTTGCCCTTCTTTCCACGACCTCCCTGTCTGGCCGATTCGCTCCCATCCTGTGTCCGGTTCGAGTCGTCCCCTGACGCGCGCGC
CTCCTGTTCCATGCGCTCGATACTGGCGATGATCTGCGCCATTTTGCGCTCTTCGCGACTCATCCTTCCCTGTGTTTAATACGCTATGTGTCTCGTATGG
CCTGTGCTCTCTTTCTCTCTGTCTACCGATCGATCCGTTGCGTCGGTCGGGCCGCTTCCTGCGTCTCTGTCTGCGCGCGCCTTCTTCCGACTGCAAAGAA
GAGCAGGCCAAAGCCCATGAGCGGCACACTCTCCCCGCGTAGGGATAAAACCTCAAGAAGCGGTTTATAAAACCTCGTCCAATACAAATTCCAAGAGAAA
AAGTACGATTCGAAACGAGACCTAACCGCGAAGTGGGATCTTTTCGTGTGCTCCACATCAATCAACAACCAGACGATAGCAACCCACGACCATCACTCTC
TCAACTTCAACAGCAAGTTTTTTTTTTTTGCATTTGCATTTGCCATGGCAAGTCTTCCTCCATCATATACAAATTCTTTCCCAAGCGAAAGCGGCATTAG
GTCGCGGACAACCGGCTCCATTTGAATGCTTCGCTGTCATCAGGCTCAAACTGCGTGTGCACTCGCGTGCTCGATTCGACATGCATGGTTACTGATTTGA
GCTCGTAGATCGTATCGGGTTTGGCCCAAGCAATACAAGACACTATTACCTTTCGCTTTGTGAAGCAACTCACAAGTTGTGCGTATATGTTGTCACTCTT
TGCTCACCCACAAGATAATGGCTGGAAAAGTAGTGCCGAACAAACTCAGTGATACCTTTAAAGTAGCGTAGTGAACGAGGTCTTGGCTTCATTGAGTACA
TCACAGGATTAATATACCGCTAGTCTAGCGCGTGTGTGTACTGTCATTTATCCAAGCTCGTAAGCAAAATGGGGTTATATGGCCCTCGAGATTGTTAGTT
GATGCACCGACGCAATCCATACACACTCAAGCTGACATTGTCAAAGTGAGGCAACGCAGAGTTCTCTGTGAGTCTCACAATGTGAGCGTATTATTTTCTG
CGTTGTTCAGATGCGCAGCTTGCGATTTCATGCAGGACTATCTCTGAAGAATGCATTTTTGCGATGACTTACGTAACCGCTGACCATCACTCCGCAACTT
CAACAACGGCACTTTTCCTCCATTATTATCATTGCTAAAGCCGACGCGAAGCAGTCATGGCAGACGCCTTTAACCTGGAGCGCGGGATCACTCCGCAGTC
AGCGGGCACGGACAACGGGTGGTTCACGGAGGGGGATACTAATGCGGCCGATTCTGGTCCGGCTGTCGTAGCCGAGATGGAGGCCGTGCTGGCTCAAACG
CCGGATGCCATCTCACTATACAAGTCGGAGCTGGAGAAGTTGTTGCTGGCCTTTGTCAAGTCTCAGGAGAGCGAGCAGCGACTGGTACACCGCACCAAGG
AGATTATAGCGGAGATCCGCTCTAGCCACGAGGCCATGGTGCGTGACCAGGAGGAGGAGAGCGAGGCATTGGCACAAAAGAAGAAGGCCAAGATGGAGCT
GGATGCTGTAGTGCAGCAGATCGCTTCGACGAGACAGACGGAGCTAGAAAAACAACAGAAGGTCAATGGCCTTCGAAGCAAACTGGAGGCATTGCAGGAA
GAAGTCTCCAAGATGGCCATGCCGTCAAATGGCGGTGACATCATGCTGAATGAAGAGCAGGAGCTTCAGATTTCCACCCTCAAGAACAAGCGTGCCGAAT
GTGCGCGTGACGTTGAGGCAAAGACGATATCATTGCAGGATCTACGACAGGAGACTAGCAACTTGTTCTCGCTGGTACAAGAAGAGGAGGCCAAGAACGC
CAGACTCGAAGAGATTCAAGCTAACGTGATGCTTCAGATTCAGGAGAAGCAGAGTCTTACAGAGAGGGAAGTACGGCGCAAAACGAGGCTGGAAAAGGAG
CTTAAGGTACTCAAACAAGCCCACGAACGACAACAGCTTGAAATTTCTGAACTGGAAACACTCAAAAAGGAGAACGAAGAGAATCTACGCAAGAAGGAGC
TGGCGATGCGCGAGTCCAAACAGAAGATGGAGAAGTACTTGAAACAGTACGACGGACTATTCCGAACGACCCATTCCTTGACAGAGGCGATGCAATTGCA
GTGGCAGAAGAACGTTGAGTTACACAAGGAGAACGTACTGGTTGAACACGAGTTGGACGTTAAGGAGCAGCAAATCCAGACGATCACACGCGACGCGGTG
AAAACTGACAAGCTCATGGAGATTGCCAGAGAGCAGCTACAAGATGTCGAAGGCAAGCGCTCCGACTGTGAAACAGAAAAGGAAAAACTCAAGCTGGAAC
TTGAGAACCTGATCAACATCACGCTTGAAGCAGAGAAGAAGCAGAGTGAGCTGCTCACGAAGAAGTTAGAGGAAATGTTACGAGAGCGCGAGGTGCTCAA
CAAAATGCTAGTGAAGGCGAATGACCGTACTCAAGCTACGTTCGACTTGATGAAGATCAAGGAGAACACGATGAAGAACTTGCAGAACGAAATTAACGGT
CTTAAAGCCCATGTAAAGAAGCAGCGTGCCCAGATCCAGCAGCTTGTTGGCGAACGCGAAAAATACGAAAGGGAAGCTGCCAACGCGACGCAAAAGTTCA
TGACGTCGTTGGAAGAGGCAAAACTGCAGGATTTGCAGGTTGTATCCCTCCAGCAGAAAATTGTCGAGAGTGAGAGCCGACTGAAACAACAGCAGAATTT
GTACGAAGCGGTCCGTACCGACCGAAATCTTTACAGTAAGCAGCTCATTGAGAGTCAAGAGGAGATCGGAGATATGAAGCGCAAGTTTAAGATTATGAAC
CACCAGATCGAGCAGCTGAAAGAAGAAATCACATCCAAAGATCACGCTCTGGTAAAGGAGCATTTCGACCACCATAAAGTGGACAAGGAGAAGGAGATCC
TCAAAAACGAACTACTGCGTATCAAAAAACAGATCCAGTCATCGGAACAGATCATCCTAAATCAAGAACAGGAAGTCACTAAACTAGCGAAGATCATTCA
AGAAGCAGACGAAGAAAAGCAGAGGCAGATCAAAGAATACGGATGTGTCGTTCATGATCGTGATACTCTGCGTCAGCAGCTTATCCAGCGTAACGAGGAA
TTGAGTGTTCTTTACGAGAAGATTAAAATCCAGAAGTCTACATTATCAAAGGGATACTTCCAGTACCAAGAGAAACTGAAAGAAGTCACCAACCTGCAGT
CACGAATTCATGCTCTCACGCTTGAGAGAGACTCGAGCAACAACCAACTGTCACATGAAGGTTCACTCAAGCAAGAACTTATCCGACTAGAAAAGGAATT
ACTACAAGAGAAGACTAAAATCCGAGCTCTTTCAGAAGAGCTCGACCATCCGTTAAACGTCCATCGTTGGCGAAAACTTGAGGGTAGCGATCCGAAGCGT
TTCGAGATGATTCGGAAGCTTCAGGCGATGCAGAAGAAGTTGATTCGTAGGTACGAGGAGACCACTATCAAGGACCTGCTCATCTTGGAAAAGGAGAAGC
TGTACGTTGAATTGAAGACTATTCTAGCACGACAACCCGGTGCAGAGGTTGCAGAGCAGTTGGTGGTTTATAAGGAAACACTCAAGGGGAAGCAGAACCA
GATGAAGCAGATGGAGGAGGAACTTCAAATGTACAAGATGCAGGTGAACGAGTATCGTCACGACCTTGGCCTACTGGAGAAGGAGAAACGACAGATTCAG
CAGGAATGGATCAATAGACAGCTGAAAGCGTACAGCAACCAGTTTGGCAACGAGCGAGGAGACGGAAACACTATGGTGTACGGAGACCCTGCATCATACG
GCAACCCGGAAGACTGAAGACTATGCAGCTCAAGTAATAATACATATCGCTATCTTGTATTTCTTGACTTAGTGAACTATTGAGGGCCACGGGTGCACTG
CGCTCGGTATGTCGGTGCTTCCCAACCATGAAGGACTGTCAGGTTCACCTGCAATGCACACAGTGTTAGCACTGTTACTACCAGCAGCAAGCATCGATAG
TGGTCAAGTTCACCTCGAATACTGTTGATCAGTGGCAATACAATTGAAATTTGCGGCAACAAGTCGTTCCATAGATTCTCGCAAGCACGGATCAGCGTCA
CGGAATTCTGGTCAATGCTTTTAGCGGCAATAAAGTCCCAGGTCCCAGCCACGCGCTGACGCAGTAACTTTTCCTCTTCAACCAAAACAAGCAACTGCTG
GAGTTCCTCGTGATAGCTCTTCAAAAGAGCAACATGGGATCAAAATGAAGTAGCAAAGGAAAAATATTGATGACAGTACCAACCTCGAGATGGATCGAAC
CTTTAAACAACACAGATATATCAAGACCTTGTTCCTTCTCCAGGAAGTCCAGTAGCATCTTCGCGTACTTGCTTTGAACTTGGGCTCTAGTGTTCGAAGA
GAATACAATCCAATGTGAACATGATTTGACTTGCTCAAATTTGGCGGCGGTGGACTCCAACATGTACAGTAAACGCTCAAGCTGACGAGTACGCTTGGTG
ACACATTGAATCACCGAGAATGCGCAGGCCGTGCTGACGATGCTCATGTTGTGCGGGACAACAGCCCTGACAACTAGAACTCTTAAAAATAGGCTTACAC
GTATATGTACAATCATCTGATTGAAGCTAAACTTTGCTAGTCGCATCTCGTGTTCAACTTGTACGCTGCAACGAACACAAAGATAGCTGCCATGTCTTGC
AATAAAATCATTCGGTGTTTTGAGCTATTACTACTAAAATCCTAAAATCCTAATGTGCTAGTGTCCTAAGCTTACTGGTTCTGGTTTTGCAGGGCCGCGA
GTTCCTCCTGGAGCCCCAAGACGTACTTCGCCATCTCGTCCCGCGATGTGCAGGACTTCAAGATCATGTTGCGTAGCGCAAGGCGCGCCGAGTCGACGTT
CGGGTCCTCTGCGGTAGTGAACAGCGGGTGTCGAGTCACAGACGGCGTCGAGTCCACCGCAATAGGCGAGGTCACGGATCCACTCAATACTCTAGCCAAG
TGCTCTGAGTGATCGTCCTGATTGGTGGCGAAGTCTGCGTGTAGTAGCTTCTTGTTGCGAGGAGAGGTGGATGCCGTTGAGCTCGAGTAAGAAGATACTG
CAACGCTGGTAGGCGACACAGGGCGTCTCATGCACAGCAGATCGGCGTTCTGCTTGGCGGTGGCAATGCCGTGGGCACCTGGGGACGATGGTGCCTGCTG
CGACTCAGCATCGGCCAAACTGGCACGAAGACCGACGCGCTTGCTGCCTCCAGCGCGGATGTGAACCAGCACATAGTCTCCCTTCTCGCCAGTACCCGCT
TCATCAGCGAGCATAACAGCATGCATGCGGAAGACCTTCTTCTTAGCAGCCACGTCGGTTGCACGGCTGTAGCACGTAGCTGTGATGTAGCGCACGATGG
GCTGCTTCTTCGGCAGACCAGTGACGAAACTCATCTTGCGCCATTCAAAGTCCTTACTCGACTCCTTCTTGCCGCCTTTACCCGCAGGTTTCTTGCCGGT
GGGAGTCATCGCGGGCGTCGTGTCACCCGTGGTCTTTTTCTTGCGTGGGAAACCGAAAGATCCCTTGCCAAGCAGACGCGAACACTTGAGAAAATACATG
CAAGACACAGGCTGGCTGTAGATGAACTCTGGGTGTAATGGAACACCTCGCGGATCTACACCAAGGTCGTATATGGGGATCTTCAGCTCGCTCTTGGGTG
TTGAGAAGATATCGAAGTATTGACTGGCCGAGGGCCAAGGTGTCTTGTCCTCCACCTCAATCTCCTCGTCCTGTGGCTCGGGCTGCGTCTGCTCCTGCTC
TGTGGACACGCGCGAGAGCACGTCGAGAAGAGCGTCGGCTGCGACACCTTCCTTGCGTTGCTTCTGGGCCGCCAGCAGCTCGGCCAGCCCAGGCAGCACC
ATCAGGCGCGGCGCCTTCTCGGGCGAGCCGCGTGCTGGGAAGGCGTAAGGCTCCGCGCTGCTGTCGGGCGTGCGCGGTCGCTTGCGGCGGATCAGCTGGA
ACTCTGGCGCGCGCTGCGTATCTCTCTCCTCGTCGCTCTGGCGGTGCATGGTGGGCTCCATTCCTTCCTCGACGTGGGTGGCTCGCACTCGGTAACTCGC
GTAATGAAACGCTGCGCCACCTTGGTCAACGGGTTGACCTTCCGACACAAGTAAGCTTGCGTGCATACAAATCGTCATATGCGAGGGAACGGGGAATTTC
ACCGTGTTTCCCTCGCGTATCTGGGGTTCACACCAATAGCAGTTTATTTGGTGTTTAGTAAGAGGATTAGATAATCCCATGGAGTTTAGTCCGCGAGACC
AGAACAGTGAATCCCGGGTCTTAGTCCGGGGTTTAGTACACGCAGCTTTAGTCCGCGAGATCAGTGATTTATTCGGATCGAGTGAATGCAATTTGCCCAA
TACAAATTCCAAGTGAATCGACCGATATGCGGTTTGGCCAGGTGTTCGCCACGCGCTGCTTATGCTTGCGATACAAAGAAATCGTGGAACACGTCATTGC
AGAATCCGGGCTCTTTGGAGACCCTACACATCGTGCGCCAGATTCCTTGGTTGCTGTTGGCCAGACATCTTTTGCTGGTGTGCGGCCATTTCGCCAGTCT
CACACTTGCCAGCACCAGATCGTGAGACTCAAACACCTCTTTAATATTTTTTAATATAGCTTTCTCAAGAAGTCCGAATTGATCTGAATCTTACGACTCG
ATGCAATGATGTCGTGATTCTTTGTTACCTGTATACACGTATGAAAAGTGTGACTCAGTCACCAGTATCGTGTTTCGAAGGTTTAAGGACAAGTTGCCTT
TTCGCCGCGACATGATCGATCGGGTGGTGGCGAGGACCGCTCCAAAGAACTGCAAGCTCTGGGCTCGTCAATCGCGGTTGCTGTGCGTGTTACCAGTCAT
CCTATCACGTTAGGTTAATAATCAGCGTGCATGCTCGGCGCTGCTCCGGCTTGTATTTACCGATCGGGTGGCGGCGGCGGCCAGGTGATAGCTTGGGTGG
CGGAGGGATATCGCTGCTGGTGCAGACAGTATCATCCAGATACGAGCAACATTGGAGCCCCAGCAGCAGATGACCACCTTCATGGACTCCTTGATGGAGC
TCCTCGCTATATAAACGAGGATGTTGCATCGTTGAGCCTCCCATGATGGGAGTCCCATCGCGCCGCTCACCTGGCCGCCATCCCGCGCGCCGTACATTTA
TCAAATTGGATGGGAGGGAACGACCTTCCGCTGACATTGGTTGCCGACGGCAACTCGCAGCACTCATTGAGCGTCGTCCTCGAATGCTGCGACGCCGACG
TGCTCGACGGGAAAAGTTCTTTCTATCGGCAGCGATCTCGGTGCGCGCACGGATCAGTCTTGAATTCAGTCGGTACAAGCCCACGCGCAAGCGCTGTTGC
TACTCGCATTGACACTATTCTGCGTTTAGAGGTGCACCTCTTCCTATCAACTCCGTTATATATTGATATAGGCAATGTTATTCGCTTTCATGGCAAGGAT
TTCTTGCTGACTCACATGTAACCTGCTGAGGCAGTTCCCATTTTCGTCGACAAGCACGCGGTTGCCGTGTTCAATTTGGCCGTGTTTCCACATCTCATTG
CTAGAGCTTCGCGACTTGTCCAATATCGGTATGAGCGATGGGTGTACCGGCAAAATTGGCGATGGCCAGCGGTGCGATGGCTGTAGATGTACCAACTCCT
GTACATTTAATTCTTGTGAGGAAGGCTTGCCACGAAGCGTACACGAAAAAATGTAGACGAATGAGCTCTATGCAGAGTAGTACTTCCAGTCGGTTACAGC
ACTGCATAATTCCGGTGCGACTTGACCAGTTCACTGCTTCAGTTTCATCATCTTCAGCAGCAAGAGTGCCCGGGTTGGGAACGCTCGCTAGTTGTTATGC
CAAGAATTGCCAGCCCCACCGCAAATTCGTGCCCCTTGTATTCTCACAGTGATGCTCACTACCAGTATCCGGTATTCCCGACAGGCACAGCATAATGCTA
TCAGCGTTAGATGGGAAATTCGGGATTTCCATTTCGCGGACTTCCAGGGCCTAGGCGACGCGGGCGTCGCGGGTCAAGTGCGAGCGCTACATGTACATGG
CATCCATTCCATACTACACATTCAGAACCCCACGGCCGAGATGACCGTCCGTGAGTCAACAGCAGGGCAGCTATCAGGAATGTAAGAGAGAGGTGCAAGT
TGGTGTCAGGCTGAACCATGTGGCGCCCCGTGAGCCACATGAGCGGGTATCTACGTTCGGCCCAGATCAAATCGAGCCGCTATCCCGGGAGAGACAAGGA
AGCCAGTCAGGTCAGCCATATCCCGCCCTTGCCCTCGCTGCTGTCGCTGGAAATCCATAACGGAGACGCTGGCGACGTCTCATTCTCCGTGTTGGCTCCA
GGAAGGACGGAAGCACACACATTGAATTGCTCGAACTTACTTGACTGCCTGCGTGGCTGTACGACTCTCCTTCATCCTCGATCTCTGCGCGAGATATCCC
CCCTTCGACAACATGGGTGAAAGCTCGTCTTTCTCAACAGGATTGATCATCGGTCCCGTGCTTGCTGCAATAGTGCTATTCACTCTAGGGGGATGGTACC
TGCGCCGATGCAGACGTCACAAACGGGTGAACGGACCCAGAAGCAGCCACAGCCAGAGCACCGAGTATGTGGACTGCGTACTGACCCCCGAGCTCATGGC
GATTGTGGCCGATGGCAGTCGTCGATCTTCTAGTACAATGGGGATCGGCGGCAAGTGGTTCCATCATTTGCCACGTATTACCAGCGTGCCGTCCATGGAA
GTCTTCGAACACCTCAGTACAGGAGGCCCGCTCACTGGTCGAGGCTCTAGCAGTGCTGCCACCACAACTGCCACTGGATCGTCACCCGTGGCCAATGGAA
CTCAACTTCGATGGCTGGATAAATGCGATTCTAGTGATATACTGGCCTGTAATGCTGCGGCACTGGAGCAGTGTCGTCTGCCTCCGAACTGCGTCGTTGA
CGGCGAATTGCTGCATGAGGGCAGCTTCACGCTGGCGTTCCGTGCAACACTAAGGATCGAGGGGCAAGCTAATCGCCAGGTGGTTGTGAGACGACTGCTT
CCAGAACTCGCAGAGCAGCAGTCGTACCGTCAAGCGTTCATGGCGGATATTTCGCTCAGTGTTTCGCTCCTACATCCACGGATTGTAGCGTTCATTGGGT
TTTACGACCCAACCCAGCGCGTATACGACCTCGATTCGCCGACATCTCCTTCGCACATTGTACAGCAGTCAGCGCAGCCCTCAGCAGTGACAGAGTACAT
GCCTAACGGGGACCTACGTGCTCTTCTTACACTGCGGCCTCGCAATGCACAAGACTTCGGGTGGTTCCATTCCGTGTCAGTGCCCAAGACCAAGGCCCAT
CTTGCGCTGGATATCGTGGATGCTCTCGTTTACTTGCACTCTCGACCGCCATCGCTCCACCCTCCACAGCTTAAGGCACAAAGAGTACTATTATCTGAGC
TTTGTGACGCTAAACTCTGCGCTTTCGGTGTAAAACGCGCCCAAGCAACGTACACTCGAAGCGACTTTTCCGTTGCCTGGTTGGCACCTGAGCTACTGCG
GGGTGAGCCTCGAAGTGAACAAGCGGATGTGTACTCCCTAGGTGTGCTGTTTACTGAACTGGACACGTGTGAGCTTCCGTTCGCATCGGGTGTCGATATG
GACGATGGAATGGACGAACAAAGTCAACTGGCTTTGCTCGTTAGCTCAGGCTGTATTCGTCCTTCGCTGTCGATGGACTGTCCAGTTCAGATCCAGGAGC
TTGTGATGCGGTGCTTGAGCTTCTCGCCGGATCAACGTCCTCCTGCAATCGAAGTGCAACACACACTACGGAAACTTATCAACGGCACCAGCGTTTGCGA
ATCATCACAAGTTTCGCTGCCGTCCAATGTGTCATCTCTTCGCAGTACACCAGGGAATGCCACACTCAACACACTCTTCACACCGTGTTGAACTTGTTAC
TGCCAAGACAAAGAAGCCTATCAACCTTTTATTCTGTGTAAATAGTAACCACCTCAGTACACTATTCGTCAACTGATCATCCTCTTAGCATTTAACGGGT
TGAGCGGCGATATCCCAGAAAGGTATTGACTCCAATCGAGTGTCATCCAGGCGACAGACAATCGGTCTATCCCCAACAGCAGCGTAGCCATCTTTCTCCC
GTAGTGGGAAGACTATTACACGATAATTCCACAAGTGGTGTCTTTGATTAAGTGGCGCTGTGTTCATTATGACGTCCCACGCGTCGAATGTCAGCAAGAA
TTGGCCACCAAACACCACGTAGCCCAGTCGAACCAATTCGTAGCTGTTTAGTGCAATTTTAGTCCGTTTACCTTTTTCGTCTCCGTAAATGTAGACCGGT
GAACATCCCAAACCTCCGACGTTGCTGGCACGAATGGCAAGAGCCCGTTCGACACCTTTGAGCTCCGTGTCTGGCTGCTTGACAGGAGGAATGTATGGTG
CAAACACCAGAGGCAGAAGGTTAAGTCCGACCAACACGAGCTTGATAGTCATCAGTAGAGTCAAGTTCGCGTTCATGCGAGGGCCGACGTCCGAGATGAA
AAAGTCCACCAGTTGCAAGTCCTCCATCTCAGCTGAGTGCACTTTGGTCGCGACTCGACCGTCCACACTCGACAGAGCACTTGAAGATGCTAGTGGTACG
CGAATCCGGTGCAGTAAGCAGAGTAATGCCAGTGTGGGCGTGAAGAACATGTCTGTGATTCTTCGACGAGTGATCTTGGCGAAGACATTGAGCAAACTGT
AGTAAACGAGGCAAAACTCCACCAGCCCGGGATACATCGTAAACCAGGACTCAGACAGTGCGATCTGTTCGCCGTCAAAGTAGCACCCGGCAGTCCAAAA
GGAAGCGATTGTAACTTTTAGGTGAGGTAGTAACACAATCGGTAGCATGTTGAAACTGCGGGATCCAGCCACACAGCCGAGACCACCAATGAACCACTCG
CTTCTACCCAGTAAGAAGCCTCGGTGGAGTGCTGCCATCGCCACGACCCAACGCACTAGTAGCATTCCCAGTGACACGTTTGCAATCAATGTTTCCCAGT
CATACATCACTCGCACAGTTCGCTCAAAGGTGCTTGTAAACAGAAAGAAACCAAAGTGTTGTGGCGAAGCGATCGTGATCGAGGTCATCGTCAACTCCTG
TTCTTCTGTAGACATTTTGTCCCCCCACGACAGCGATTCAGACGAAGTTAAGCACTCCTTCCGGTTAATAACACAGTCCAGTTCTTGCTTAGTTAGTGTG
TTGAATTCGCGTCTCGTCAGTCCATCAATTGACCCCGGATCGGAGCTGATGACATCTGAGAAGTACGGGGTCTCCGATTCGTCTCCATTCCCCACATGTA
GCCATCCATGTCGCCATTTCCCATGAGGTGCTTCGAGCCACCTCTGGGTTAAAGACTCTCTCACTGATCTATTCACCGCCAACATCGCTGGGAATCCATC
CGTTAAAGTCGAGTCGACGTATTTACCAGTTAGACGAAACATACAGGCCGATCCATCCGTTCCAGGCACAGCATAACGTGCAATGGATGCGTTATCCCAG
AACGGCATCACTAGCACCGGTAGAGCGTTCTTAATCAAGTAAACGGTATCACTGGTACCACCATAAGTTTTCTCACCGTTCACTACAATTCGTAATCCAT
CTCTTGTGACGCTGTAGCCCAGATCGTTATCACAAGTATCCAAGATCATATCCAGAGTCGTGGAAACCAAAGCACAAGTGTCCATATACGTGGCATAAGC
GTCGTCACTGAGTGTTGCACCGTGACGACGTACGACTCGATATCCATCAACCTGGGGTGGTGTAGTCTCTGGAACTACCGACGCACCAGAAGTTCCAAGC
ACGTCGTTAAGTAGAACAGGCTTGTAATACGGTCCCTCGAGTACACAAGCCAACACACGGTCGGTGACGACTTTATCATTATCACCAGCGATTTCGCTCA
TTCCTCCCGCTACCGGGTAACTTCCGTAGAGTGCTCCACCTTCAGAAGTAACAGTGTTCCAGAAGAGCCCCAAAAACTGGGAGAATATCAGTACAGAGAT
GAAGATACACGTTACCCAGTGATATAACGCAATTGCAATTTGTCTTGATGTCGGGCGTGGAGAGGGGACTTGCTTCTTTCTTGACGGTAACGTTTTAGCT
TGTGGAATGTTGGATCCAGCGTTTTCGTCTCCAACAACAGCAGGAGGTCGACTACCCTCCAATTTAGGCGATAGACCCTGTTGGGTACATGTATTCACGC
GGTGCAAGCCGGAATGGTCATCGCTGCTGCTCGTGCTCGACATTTCGGCTACCCTGAGAGTGGTTGTGCGTTTGGGTCACTTTTGGAATCTGGATTGTAT
CAAAATAACGTCGACGCTTACTAACCGATAGGGGTGTCTGGATGTGAATATCCACAGATTCGTCGAATGGTTGACACTTTTTGAGCTGACGCTTTAGCCT
TGTCAATCATCCCAGCTTGCTTTGCAGCTAGGCATATCTGTAGATGTAGTGTTTCGGTGGTGTGGTAGTGATCGGGTAGACCACATCTCGTCCAGATCTC
CAGTAACATGTCCGCAGCTTTGATGACGTTCGTCCAGTCGCATTGAACTCGAGCCATCTGCATTTCCGCAGTGTAGAGTGCAAATTGCGCTTCACTGCTG
CGTTTGAATACATTTTCGTGCTCTTTCTTCAAGTGAGCAATTCGCTTTTTCACGTCGCTTTGGTTTGAGTTCACGATCTGCATCAATTGCTCCATAACTC
GAGCCTCTTCCTGTTCCTCCTCTGCATGATCTTGTTCTTTAGCTTCAGTTGTGCAGCGATCGCAAATGCAGTCGAAGTCGAATCCCTTTAACAGTAGCGA
CTGTCGTCTCCTTCTCGTCTGCAACAAGTCAATGTAGGAATACTCCACTGTACTCCCTTTTGGTATCTCTGTGATAGCATGGAAAGCGAGCGTTCGGGTG
CGTGGATCAAAACTGGGTAACACGTTAGGTAAGCACGAGTGATTCAACGCCATAGCTGCTTCGGGGAACACGCCAGTGCCAACACACGTGACGCCGTCCA
AGTAAAGTGGATGCGCATTACAGCGCACACGCTCTAGCGTAGCCCGAACATGCTGCTGGTCCAGAACTCGCCCTATCATCTCGACAATAAACTTCACAGC
AGCGCGAGACTCCTTCTCTTCACTGTTCTCTTCCTGGCGATGAACAACTAGCAGCTTCAATGCTTGTGAGTTTCGCACAAACTGCTCCATACTCAGCACT
GCCAGTGCCAAGCGTACAGTCTCCACATCCCCTACATTAACATCTCTACGTTTTAACGCGCAAAGTGCTTGACACTGGAAGTCATGCAGCGCTGCGTCTG
TATCCAGACAATCACGAGAACTCTCCGCACTGTAACGCGGTCCGTCGCAGCTTCGCAAAGCACCAGTGGCACCTTCGAGGCACCAAACTCTGCCGGACAA
TCACAGCGAAAGCTGCAGCTTGAAAAGCACGCTCTCCGGCGCGAATAGATTGCTTGGCGACTGTGAAGCGACCCATGGAGCCGCTGGTTGAGCTCCAGAG
AGCCACGCGAGGGTTATCAACCTCGAATTTCGAGTCATGAGGGCCACGACCTAGTGCTGTATTGGCGTCAGGTGACGCAGGGCCGACAGCGCACACGTGG
CGCTGTGGAATCCACTGCGAGTGCAGCTTATTAAGCTGTTGAGAGGCGTTGGAAGCGGTGGATGGGGACGTGCACTTCCAAACAACGTAGCACAGGTCAG
CGTCAGAGTTGACGCGCAGAACTGGAGCATGTAGTAGATGAGAGGATGGACGTGAAGAAGGGCTATTAGTGGAGCTTGGATAGCGATGTCGGCTGCAGCA
CGCGGGCAGCGAGACGCCTGTCACGAGCAAGTCATTGTCGGGGATGGTGGACATGATGCGAACTTAGTGATAAAGCTGCGAACCTAATGAAGGGTAAAAA
TGGTGTACAAAACATCACATTTTTTGGCTGAAGATCGATTCTACTGTTAGTCGAATGAGTCGGGCACTCTTGTTGCATTAACCCAAGAAGCCTTCGCGGC
AATCTTCGCCTCCAGTAGGACGATCTCTAGTGTACATCCATGTAGTGTCTGCTGCGAGGGAAGCAGCATTTTGTGTGCGTCCGAATTGCGAAGCACTTCA
TGGGCTAAGCACTTCATGGAGAAATGTACAGTGAGTCTAGTGAATTGAGTGACGCGGTCAGTTACAACTGTCGAGCCGTTCCGTAAATGGTTGGAGTCGA
TCGTGATCGTCTTGCGTTTCACAGAGCTGACGCGATCTTTTAGAAGACGAATCGTTCCACCGGGGATGAGCATTGAATTCGACTGTACAGTACGTGGAGC
TGTCTATAACTGCCTGGCACTGCAACCAATGCAGTGCAAACAAAACCCGAGGACTTTGCGCACGCCGCCGTACATGTATCCCCGCTAAAGCACCTCCCTC
TTCTGTCTCCACTGTGATAGTTTTGCGTTGCTCATGCGCACTGTAGGCTCTGTCTCTTAAATATATGTATAAATCACTCATGCCACCATGACATCCACGG
AAAGTCTCCGTCGAAGACGAGTCGCTCCTCCCATCTGCAGCGATGATCGGCAAAGCAATCCAACTTGGAGGAGCTGTGCCAGGCAGCCAACATCCTCGCT
GGCAATGGCTTCTTCCACCAAGAAAATCTACATGTTTGTGAGCTTCTGTTCGCTTCTCCAGGATCTCATTGCTGCTCGTGCTGACGTTGCGATGTTGAAC
TCTATTGCATAGTTCGCTGTGTCCAGTTGGTCGCAGATCGCTGATGCGCATTGTCAGGTGTTCTGGCCCCAGACAGGCAGGAGTCAAGTTTTGCAGCGCC
GCTCGTCATGTCCGCGTGGAAGACGATCCCTTTTTCAAGAAGTTCTTCCTTCCACCCCCGACAAACACGGCGTTGGGAGTCCCAGCTTGGACATTCCAAC
TTGCACGCGTAGATTCGAGCTTGGTAATCCGCGCCGTATGCATCAGCTTGCACAGCGTTTCAAGCATGCAAATTTCGCAGAGATTACAGAATCAGAGATC
GGTTCTGGGCAACGAAGAGAGCTGAGTATCGCCAGAGACACAGAGGACCCTCACGATCCAATGCTCGAGACAAGAACACGGCGGTCGGTTTGCGAGCACT
GCCACTGCAACTTACAACTTGCAGTGCAAGTGGCGTGCTGGACTCTCAGCGTGGCAGGCAAGGCAAGCCGCACGGTCAACGGAAGAGGACTGGAGGAGCA
CATTTGGTTCCATCCTTGCCCCATCCTCCTCCAGTTTAAAAGAGCCAGCTTTGCTGCACACTTGCAGTTTTATTGGTCAAAATTCAGATTACGTATCTGG
TGGATATTGGTCTTGCCACAATTGATATTCATCAATCATAACAGATAAATCAGAAATCAAACTTCAACAAAACAGCAAAAGTATCAGCATAACAAACTCT
CTCTTGTCTCTAAATATCGCAGATCGCAGGTTTCTAGTTGATGATGTCAAATGCAGAAGAAGCACCGCACCCTATCCCCTTTCCCCCCTCTCCTGCAATT
TGCCTCGCAGGAAAAAAGCTGCCAGACCAAGTCTCTCTCGGTCACACGCAGGTCGCTTCCCCCTCTTCGGGCTCAAAGCGTAAGTAAGTGTACCGACCGT
AGTGGCGCCCGCCACTCCCAGCAGCTATCACGCCTCTCCATCCGGAGTCGCCAGGGGGCGCGCCCCCCGTACCGGACCGCAGCGAGCCGCTCGCGATCCC
TCAGAGTGGCAAGAAGCCTCGCTCTGGAAGTATCAGCGGCTTCGGCAGCTTCGGTAACCTCCAGCTCGCAAGCAGCTCTAAGCGCAAGGGCAAGATGCAC
AGCCCTCACACATCCTCCGGCCGTCGCGGCAGCGTCGCCTTGTCCAGCAGCGCCAGCGCCGAAGACTCGTGTCTGTTTGTGGACAACCTGATCCGCGGCG
TACAGCAGCGTTTACGCTCCGAGCTGGGCTTCCGCGAGGTGGTCGTGGCCACAGGCGAAGAGGCTGATACCGTTATGGACTCAGGTCGCTCGCGTACACT
ATTGGCCACCTCCATCTTGAACGACCACGAGTCTCCCAGTAAGAGCGAGGAGCCGCAGCCCTGGGAAGCCACAGCCGCCAGTAAACGCCAGCTGCTGTAC
GGCAAGGACGTGGACCGCAAGAACAGCGACGCGTCACTCTGCAGCGAATGCGCCAAGGGCACAGTATACGTGTCGGACGGCTACGAGAACAAGCAGCGAC
TACTAGTCATTGTGCCGTACCGAGAAGCCGGTATCTGGAGTCGCAGTATCTGCATGAACCAGTTCGACAGCGACAGCGACAGTGGCTCCATGATGTCGTA
CTTAAAGAAAGCATTGAGCGAGAACTACGGCGTGGTGATCATGAACCCAGCGGCTCAGAGCTGCCACCCTCGCGCACACGTCGAGAGCGCGTGGGACCAA
CTCATCGCCCCTCTGATCAGCGAGGTCTTCATCGTCGCATTCTCACGTGGTGCGCAGATGGTTCTGCATCTCCTCAACTACGACAACGGCCTGGGTGTGA
TGCAGGACCGCGTCAAAGCTCTAGCACTCGTCGAGCCGTCGCACTACGTCAGTGACAGCGACACGTACTTTGCTCGACGAATGCTGGCGCGTCGTGCTGT
GTCCTGGATCCTAAACTCGGAGATCGACGTGGGCTGTAAGATCCCGCAAGGCCACACACGTCACGGCTGCGTCTGTGTGTCAGCAGGCACCGTACCGTCC
AATGTACTGGGCAGTAGCGGCGCATACGCTCTGGAAATGGTCAAGAGCTCTGTGTTCGGCTCGTTTGCTGCTCGTTGCGGTGAGGCAGCGGGCATTACAG
TGAACGCCAATAAGATCAACGCGTGTGGCATCTGCCATCGCAAGCTGTCGATGCTGAACCGAAGGATCCCGTGCTCCTGGTGTGAAGTCAAGTACTGTAG
TCGCTGCTGCGAGGACAAGTTTGTACCTGCTTTTGGCAGTTGGCGCGTGTGTTCGCTGTGCCAGTCACTACCGTGTTTGATCGACCCTCGACGTAAGAAT
CGCAGCGCCACAAACCACACGAGTCCTACGGCTGCTGGTCAGGAGCGCTGCAGCGTGTTCATCCGTCCTACAGCGGATGATGACGACCCGGTGTGTCTGG
GAGACTTTGAGATCGTCAAACTCGTCGGTCGTGGCGCTTGTGGTCGTGTGAAGCTGGTACGTAAGAAACACGGCTACGATGAAGGCGTGTTCTACGCTAT
GAAGGCTATCCGCAAGAAACTGGTGATCCAGCGTGGGCTGGTGGAAGCTACGAACGCGGAGCGACGCATCTTGGACCGGATTAAACACCCGTATGTGGCT
ACGCTGTGCTACGCGTTCCAGACGGAGGCCAAGCTGTATCTCTTGTCCAAGTATTATCCCGGTGGCAACCTGCTGGACCAGATGCGACTGGCACGGAGAT
TCACGGAGGATCGCACTAGACTGTACACTGCCGAGGTGGCGCTCGCTATCCGTCACTTGCACCAAAATGATATTATTTATCGCGACCTCAAGCTGGAGAA
CGTGCTGGTGGACTCGGACGGTCACGTGGCGCTCACGGACTTTGGTATGTCGAAGGAGAACATGCCCGATGAAGGTCGTACCACCACGTTCGTGGGCACG
TACCAGATGATGGCTCCTGAAGTGTTTAGTGGCAAGTCGTACTCCCGTGCTGTGGACTGGTGGGCGTTGGGTGTCATGGTGTACGAGATGATCGATGGAC
GTACACCGTTCAACGCCAAGACCAACCGATTGATCAAGGAGCGGATTGTGAACGTGGACTTGAAGTTCTCGCCTCGGTTTACGGAAGATGCCAAGGACTT
TGTGTCTAAACTGTTGACCAAGAACGAGGACAATCGATTGGGTTCAGGAGAGCATGGCTTCGAGCATATTAAACACCATCCGTGGTTCAAGGGACTCGAC
TGGGACAGTGTGGAGCGCAAGGAGGCGTTGTTTGAAGGCCAGTATGCGCTTATGGAGAAACACGCTAAGGAGTACCGTACTGAAGATATCTTTGAGACGT
ACATGAACACCGTGGAGGTCCCTATCGACACGCCAGCGTCGGTCAAGAGCTCGAATGATGAATTGTTCAACGACTTTGCGTTCAACTACATGGACGGACC
TGATGAGGAGCAGCGTGATGTCCCTGAGCCGGACGAAGAAGGAGACACAGAGAGCCCATTGTCTCCTGTATCGCCTGATGGCAGCACGGAGCGATCATCC
AAGCCGCGACCGCTTACAGTGAGGGAGGACAAGATGTTGGACACGTTCTTGTCTACCAATGGCTCGCACTTTGACTTGACGCTGCTGCGACCGAACCAAG
CGACGGACTTTGGCGTCTCGGGTTGCTCGTCGTTGAGTTCGGAGGGCACAGATGACGAGGGCGCTGAGCCCGTGGAACAGCTGGACGATCTGGAGACAAC
GAAGAAGGACAAGAAGGACAAGAAGCCGTCCAGTCCCACGACACAGCCAGTGTCGCCCTCAAGCAATGACGGTACGGACGTAGACTCAGTGCTCACTAAG
ACTGGAAGCAACTCCACAGATGCCACCGAGGAAGCCTCCAAGGCCGAGTGAATTTGATGTGGGTAAGTGGACCAGACGCGGTCGAGGAGGCGGTGGAGCT
GCCGCGTACAAGGCTAGTGGTATGTGTGGAGATAACTACAGAAACACTGGTATTTGATGAGTTTAGACATGTTTTCTTATTTACAGCCAATCGCAGTACT
AGATTTTGATTTTTAACCAATCATGTTGTAATGTTGAAGTTGCAATAATGGAGTTCAAGGATCCAGGTATCGGAGACGACCGAGACGTCTCCTGTGCGCC
ACAGAGCGATATAAGAGACGCAACCAGCATGGATAGATGGACAGGATTCTTGCAATTGTACGAGTCGTTTATTACGCGGGAATTGGCTCAAAAATACCCG
CAATTTGTCCGCGCATTGCGTCAATTGGAGAGAGACACGCGTCTTGAGCAGGAACGACAGAACGCGCAGGTTCTAGCAACGTTGAGGCTTAAAGATGCAA
AGATCTCGGCGCTGCAAAAGGCCGTGATTGAGCAGCGCGAACAATTAGACGTCGTGCTGGACGAATTAGAGCGAAGAGAGACAAAAGTTGACAAGGAGGT
GCAGATGGGGGAAGAGAGACAGTTGGAGGACGCTGCAGTGCAGACGAAGAGTGTTGCGAAGGAGTTAAATGAAATTAGTACTCAGACAGAGAAGAGTGAA
GAAGAAACTGGAGTTTTAACGCTCTTAGAGAAGCTAGAGAAGGAACTGAAGACGTTGGAAGAGAAGAACTTGGCGCTGGAGAAGGAATTGCAACATAGAG
TGAAGAAAAATGAGAATGAAGAGAATTTCGAGAACAGTGAGGAATTGGACAATTGTTTAGAGGTTCTACAACGCGGAATGGAAGCCATGAACTTGTCCTG
TGGCTGTGTGGAGAGCCCGCTGATGTTTTTTGTTGGTTTGCCTGGTGAGGAAGAAACCGTGTCGACGTGTGTGAATCTAGAACATCGTCTGGAAGCACAA
GCGGTTCGACTAGAGCATGTTCAAGAGTGTTTGTATTTATGGCGTGATGCAGCGGTGCAATTTATGAAGCGACAGGACTCTAGTGACAGTGGAAAAGAAC
TGACACTTCCGTCAAGTTCGTCGTCGGGAATTGCTCGACGGGATGATAATATTGCGCCTCAATGTTTGACCGCTCTTC