Description :
From Genome Similarity Track
Location :
contig_7:35758- 38026
Transcript NameFunction/comments
g2314.t1GBG66957.1 hypothetical protein CBR_g74645 [Chara braunii

Sequence
2268 bases(100 bases per row)
TGGTTAAGGCAGATGCGTACTCGTGAGGCAGCACGTCAGAATCGTACGATAGACAACAGAAGAGGGTGCTTCTCTCCTTTTCTGGGATGTACCAGTCTGG
AGCAGAGACTCGCACCAGCTCTCGCTCGGCTTCTTCCGTGACAAGGTGCTTATACGAAGCATGCCACTTCCTCACGTCGAAGTCGGTGCTCAGGATATCT
TTTAGCGGAGCGTGTAGTTGATCCACCTGAAAGTTTTCTTTGGCTACCAAGCCACAAAGAGAGAAAACCTTCTTGACGTCGGCTGCCGATTTGGAGCTCA
CCCAATCAAGGGTCCACTGGGCCACAGTGTCGGAACGGAGAACCTTGGGGTTGCCGGCTTTGGTCTGGAGGCTCTTGTCTTGGAGGGCCAAGCTGATGTA
CTCATCGAACTTTGACCGATAGAATTCCTGGTAGCTCCTGTTGACAGCGACGTCCAGTGGCTGGAGCAGGTTGGTGAGATTGGGTGGGGCCAAGAGAACG
AAGACGTTATAGCGTTCCAGTCGCTTTGAGTCCGCCAGTTTCACGTGGCATCCATAGGAATCAATCAGATAGAGGACGGGCTCTCGGTAGAGCTGCGTCT
CCTTCCTTCCGCAAACCACTGTCTGTGCATGAGCCAGGAGGAGGTCTTCATTCCACATGCCGGTCTTGTTGACATCCACAAGAACACCAGCAGGACACTT
GGGCTTGTTTTTCAGCTTGGAGAAGAGCAGGTGTGGCGTCAGAAACTCGCCCTCCACTGTGGTAGTAAACGTCGCTGTGAAACACTTGTGGCTTGAGCCG
CCCTTTCGCAGCAGAACCTCACGAACGCCGCGGGTAGTTATCGTTGATTTGGGCTCAGTCTCGAAGTAGCGAGGGACCTGGTTCATATTGATGATGTTTT
TGGGCTTGATTCCATGCTTGGCGATGAGGTGTTGGGCTTGCTGGATGAAACGCTGACAAACGTCAGGTGCATCAGCTGGTAGAGTCCGGGTTGTTGTCTG
TCTGCGTGACACCAAGTTCCGACGTCTCTTGAATCTCGCTAACCAATCCGACGAGGCCTCGAAGCCAGCTGCATTGCCGCCGTGGAGTTCGCGATAGATG
TTGACCGCATGCAGCCGAATGTACGAGTCTTTCACACGCAGGCCTTTGCTGTTCCGGTGGGTGACCCGCTCGTAAAGCAACTCCTCCATGTCACTGTGAG
CTGGTCGTCGCCCACCACCGTTGAGGCGTCGGGCCGTTCGTGTGGTAATTCGTCGATCGCGCGAAGCCTTCTCCAGCTCAATTCGTTTCGCCTACCAGCC
TCGAATGGTGCTAGACAAAACACCGTGTTGACGATCAAGAGCATGAAAACCCTTCCCTTGAACACCGGGCTCATATTCATCAAGAATTGAGAGCTTCTCT
GTTATTGTGAAGCTGCGTCGTGAGCTGGGCATCGTGCACTGGAAAGCTTCTGGTGAAGGTGTTGCTGGTAACGAGTGTTTTTGTTAATGAGCTTATGAGT
ACATGCAACGTCGATGGCCACCGGTAGAGAAGAATGGTTGGAGAGTAGGTGGTCTAGCCATTTGTTAGAGTCAACCTAGAAGCCTTGGTTCAGACCTCGT
TTAAAAGAACCCTTTCCTCTGTGGGCGTCCTTCTATTCCGATACGTGTTGTGATCGGGGCTTTATATTGATTTTGAGCACATCGATTTTTTATTATTACG
CCTAGACACTCTATGCGGGGTAAGACGGTAGGTTAGGTTAAAACCCTAAGGAACAGTGGACCACACTTCGACTGAGATGCCAATTTTGATCCTGCCCGAT
TATTGTTTCAGGACCAACTCGTTCTCAGCGTTTTTTTTTTTGCTTGAGACTCTGTGTGTTTGGTAGTGGTCAAAACGTGTTTGATTTTACCCAGAAAACT
ATTTGGTTTTAACCCGCAAACCAATAAAACGATATTTCGGTGGCGAATTGTCATCAAACAACATTCACGAAACATTCAATTCAGTCGACTTTCCAGCAAC
ATTCTTTCTGAGCATTAAACCGGAAAACAAAAAATACAAAACTCCGAACTGCGAATCAAGTGTGCCCGCGAACCAATAAATTGATGACATGCAACGAAAG
CTTGTCAGAGCGAGAAATAGATGTGTGAGATGACTTTGGCAGTTCAATATACCCTTCGCGCTACTTAGTCGTGCCCAAATATTGAGGTCACAACAGCTAA
CCAAAAGCTCAGATTTCTTCACGTAAACCATAATTAGTCAGGGGTCGACTAAATAACGTGAAGGGTGT