Description :
From Genome Similarity Track
Location :
Scaffold_288:35754- 36943
Sequence
1189 bases(100 bases per row)
CCGCTGCACTTGGTAGCACTTGTAGTCAATCTCGCTCCTGATTCGGTTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGTGAATTTGCCCCCG
GCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGCGTGGCTCATCTTGCATTGCAAGCTCCAGAGGCGGTCACCGCCAGGCTGAA
ATCGCTCTCACGCTACGAGAACGCGCTCTTGGAGCACGTCCAAGAGAAGAGGAGCGCCGCAACGGAGGCGGCGTCGATGGCGCGTGAAGCGTCTATGAGA
CTGAAACTGCTCATGGTGAGCGTAAAACCTTCGAGGGGAAGAACGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGACATGGGATCAGCCCT
GCTCCAGTCTGAGTATCAGCGCGTGGCGCTGGCTATCGCCAGGCTTGGAGGTCGATCTCGCGAATGGGTACTAACGTGCGGCACGTTTGTTGACGCTGCA
TTTCTCACTTGGGATCGGCTGAAGCAACAGCTTTTGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGCTTCGCGTCGAACGTCTTCCTCTGA
CGCTAAAGCTACGGCCGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCTCGCTCCTGATTCGGTTAACTATATCCTCTGCGAGGATGGAACACCCCGT
GTTCGTGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATTGCAAGCTCCAGAG
GCGGTCACCGCCAGGCTGGGATCGTTCTCACGCTACGAGAACGCGCTCGTGGAGCACGTCCAAGAGAAGATGAGCGCCGCAACGGAGGCGGCGTCGATGA
CGCGTGAAGCGTCTATGAGACTGAAACTGCTCATGGTGAGCGTAAAAACCTTCGAGGGAAAGAACGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGA
GATGGACATGGGATCAGCCCTGCTCCAGTCTGAGTATCAGCGCGTGGCGCTGGCTATCGCCAGGCTTGGAGGTCGAGCTCGCGAATGGGTACTAACGTGC
GGCACGTTTGTTGACGCTGCATTTCTCACTTGGGATCGGCTGAAGCAACAGCTTTTGCGCGTGTTCGCACCGCCTAATCAGGCGTACCG