Description :
From Genome Similarity Track
Location :
contig_26:35747- 38872
Transcript NameFunction/comments
g6721.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g6722.t1hypothetical protein

Sequence
3125 bases(100 bases per row)
AGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGACCTGCATCCTCTCGGACGTCGAGAGGGTGACGTGTGAAGCAGAAGAGCTGA
ATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTA
CAAAGGTCTTGCGTGAGTACAAAAATGTACTCCCGGACGAGATTCCTGCGGAGTTACCTCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGG
AACGAAGTATTGCGTCACGCGACAGTACGTGGGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGT
CCCCGCACAGCGCGCCTACGTTCTGTGAGAAGAAACCAGAGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCGCA
GACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATG
CGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGT
TCAACAGATGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATC
GGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACC
GAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAA
AGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCTGCTGTCGCAGCTCTTGAAGAAAGA
GGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGC
CCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACACGATCACGAAGGTCGTGATCTACCAATCGCGTCAGCTGAAG
CCAGCTGAGCGCAATTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCG
TGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTT
CCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGTCCGACGCCAACGCAGTTGGC
GTCGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGATAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGGGAGTACTTCTCCACAC
CTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGA
CAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTGACCCCGACATCGGGACATCCTGGCCGTGAGAAGACAT
ATTTGCTTCTCACGCGTGACTTCTATGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCC
AACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGA
GGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGT
CGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTT
GGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGC
ACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGC
CATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCT
GATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACG
ACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAAGCTCGGATGCAATGGACTTTGTCCAGCGTCGAC
AAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAA
AGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTC
ACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGC
AGCACGAGTCACCTACGTCTGGTGA