Description :
From Genome Similarity Track
Location :
Scaffold_128:35747- 37068
Transcript NameFunction/comments
Phyra_84871synaptic vesicle glycoprotein, putative

Sequence
1321 bases(100 bases per row)
TCATGTCGAATCAGACCCGCCTGTTCTCCTTCGTCCTCGACTCCGCGCGAACTCGACGCATCTTCGGTGCTCGCCTCCAAATCCTCGCTATTGTCGCTTT
TACTAACAGCGTCGATGTCGTCATTTCCACCGTGGGCAATCCAGCGCGAGGCAACGCCACCCGATATCATGACAGTGGTCGTGACCAGCAGTAGCGCCTC
AAGGTGCGGTGGGGGTCCCATGAGAAAGCCATTCACGAATTGCGCTGTGATGGCAGCTACGCGGTTGGAGCAGTTCACTACCGATATACCCGTGGTACGA
AGCTCCTGTGGGAAGTTTTCTGCCGAAAGTACGCCAAACTGAAGTGACAGCACAACAAAACCCACAACATTTCGTTAGTCGTAAGCACACATGCAGGCCA
AAGAGAGGCAGTTGAGTACCCCATTCCAAGCTGCTGTAGTACACGCGTTGAATAGGCACGAGACTAACACGATGATCGTTTTTGAGCCCTCAATGTTAAA
TGCAAACAGCAGCGCGCAGAATCCTGAAGTGAACAGCGCTCCTGACAGAAGACGCTGATGGCCGATGATATCGATCAAGTACAGACTACAATACACAACA
CCAGGCGTTAGGCTGCAAGTATTCTCAAATGTGGTCCACCGCTTTTACGCACCTGACAATGTTGCCGGGTAGATTAGCCCCGGCGAACAGGAACGCATTC
TCAAATGGGTTTGCTAGTCCAGCACTTTCAAATAGTTTGGTGATCCACGTCGACAGTCCGTACGAGCCGAAACTCAACGAAAACCCGCACAGCATCAATA
GCAACGTCGGTCCAGCGTTCGGCTTTTCAAACAGACGTGCGACAACACGTAAACTGCCACGACTGCAAACGGCACTGTGTGGGTTCGCCTCTGAGGCGTC
TTCACCCTCAGAACTCACACCGCCTTCCATCTTTCGCCGCATCTTAGTATCCTTGTCATCTTCAGTATTTTCCTCGGCACTGGAGAGCTTGAGTTGAATA
TGTCGACCACTTTGATGCACGTCGTGAATGTATTGCAGCACCGACGTCGCTCCTTTGGCATCACCCTTACTCGCCAAAAAGTGAGGGCTCTCCGGGACGT
ACCACAGCGTCAGCAGGAAACACGTGAACGACGGTAGACCGACCACCCCGGCGAACCAGCGCCACGAGAGCTCCAGTATCCGTTCACCATTGCTGAATTT
GCCTAGCATGACCCACGCCGTACCCGCAGTCATCACAGCCCCCACCATCCAAAAGGAGCACAAAATAGTGACGTATCGTCCTCGTGCCGACACCGGAACA
TGCTCCAGACACAGAGCAAAA