Description :
From Genome Similarity Track
Location :
Scaffold_212:3574- 5900
Sequence
2326 bases(100 bases per row)
CCTCCCCCCTCCGACCAAGATTCTCACTACAGCAAGGTGAGGATACGTGGATGGCGGATGGAGCGTTCCATTCATGAAGAACGGGCTATTTGTGGTAAAG
CATGCACCTTGTTATTGATGGCAAAAAGTACTCCATCGGTAAGAAACTACTCGACCATTTGAAAGATTGGACGTATCATCGAAGTATCGCTTTGAGGACA
AGATCGATGTTTTCCTTTTTCCACCCATTTCAGGTGATTAGAGACACCTATCAGTGAGTTCCAAGTAATTGAAATATGAAGCGCCACCACTCTTCTGGAA
ACCGTGAGGCTCGGTCACACAGAATTTCACGGGTAAACCATGAATACAAAAGATCATTTCAATACAAACACAAGCACAATCTATAGCTGTGATCAACCCT
AGAATATCAAAAAGATGCAACATCTTGCTGAATCGACCAATAAACACAAGAATACCCATATAACTATGGTCAACCTCGCGGATACATGAAATGGATTCCA
TTGAAACAGACTCCCAGCATTCTGGTGGAACTGGTAGAGGTTGTTGTGGTGTGTGGCGTGAAGGAAAAGACTTCAATATTTGTCATGCCTCAAAAGCACG
GACTTCCTTGCGCGCAGATCAGATTATAGCGGCATCAGTAAAATTTCGGCTAGCTGTGAGATAATTTTCCTTTCTACCTCGACGGCCACTGAAAGGAGCT
TTTTGGCACTCATAAGTAATTCTCAGGCGCATACTACTATGTTTAAGAACTCCGAAACGTGCTGTTACGCCAGCAGCAGCTGCGTAATACAGCAATCCGT
TCCGTAAGGTGTATAAATCTGATGAGCATGGATATACCGCCGAAAAGATGTTCAAGGTTTGTCGTGATGAATATGACAGATGATTCATCAAGTGCATAAG
GTTTTCATCATGTGCATATGCATTTCTTACTTTGTCAAGAGAAGTTGAAGACTGTATAATTGAAGTTACCTTTGCAACAGTGGCTGTCACACAATTGAGA
TGTGCAGCCGGTTCGAAATAGAGCAGCGCAAGAGAGCATCGTCTGATAAATTAAGTTATCATGGTTTATACTCGAAGGAAAAGTTATACCCCGCAAGTAA
CTATATCTACTCCATGCCAAAATTTGATAGAGGTGTGTAATTTGTACAGACGTGCGTAATGACGCAAGGTCCGTATAGACGACGGTGGGTCCATCCCCTA
CTAGATAGACTGAACTTGCCAGTGTGTGCTTCATAATGAGGTGCTCCTTCTCATACACAATATAGTTGCGCTCAGATGTAGCAATTATATCAATTGATCG
CAGAAGACACGCTCCGCGCCTTCTGTGTGAAACTTCATTAATGCCCAGCAGCATTCAAATCACTGGAGTTACAAGCTACGTAAATGGTATGTATTCGTCC
GCAACCGGCAACGTTGATCATAGTATCAAACTCTGCTTGATACGTCGGAGGAGCGCTGACCTATCACCACTACAAGTCCACTTCACGTTTTTGTTAAGTA
GAAAATACGGGTGCTCAGTTATTTCGGCGTTGTTGCGTGAGTACTTGTGCAGAATGATCTGCTAGTCCAGTGAACGTGTTAAATCTCTTGACATCGACTG
GTATTACCCATTTGAAAATTGCCTTGATATTTCTGGATCAGAGAGCACGCCGTTATTACCGGCGATACATCCAACCGAGGGTCTACTAGCCGCAACAATG
AACTTCTTGAGGTTGTCAAATTTCTTATGCTTTCGCATAACAGTAACATGTGAAGGCGGTTTTACGAGCCTCAGCGTAAGACTTTTCATCTATATTTCGT
CTATAATCGGAGACATCACCGATATACCCGGTTCGAATTCTTTGCACCTGTCTTAACAGATGTAAAGCACGTATTTTGAACTTAACTGGTGCTTTATTAA
GCCCTCGCGCATTACCATCCATTCATCGAGCATACCACATGTAGTATTCATTGCGGTATATGATATAACTCATTCCACATATGATGGAATCCTTCATAGA
ATGCATAGACGAAACGATGGAAGTCTTATACATGCGATCCATGATTACGTCTTCCCTTGGTATAGACGTCTGAGTCAGTACCTTTTCTTCATTCACTTTG
CTGATGTTTTTGCATTCTTTGTTGAATGCGTGCACTATCCGACACCCTCGTGTCGTCTCTCACACACAGAAGATTAGATATCTATGTGATAACGTCGATT
CCTTCATATTTTACGCTGCTAAGCGATCGGAAAATAATTTGTCGTTTACTACGAATTGTTCTCGAGGAAGTAGCACTGCATAATGATACTGTATTTTAAA
CCTGTTTTTAGGTCTATCTTGTGATG