Description :
From Genome Similarity Track
Location :
Scaffold_286:3574- 4678
Transcript NameFunction/comments
Phymu_g8077hypothetical protein PHYSODRAFT_258317

Sequence
1104 bases(100 bases per row)
GTCATTCCAAACTGACCTCTGTTACCAACTCGAAGTTTTCCAGCAATGCAGTTGTTTGCCCCATTCCTCGCCGCATTTGCACTGCTCTGTGCTGGTGCAG
TAGCCAACTCCACGTCCGATGAGGAGACCAAGACCATCGATGAGCTCTACGCTGATGCTATAGCGGAAGGCGGCAACCTCGTCCTGTACCATGGTGGAGA
TACGCCGACCTCGCAGGACAGCTTACATGCTGTCATTGAGAATCGCTTCCCGAAGTTGAATTTTACTGCCGTCgtcgactacagcaagtACCACGACGTG
CGTATTGACAATCAGTTGGAGACCGATACACTGGTCCCCGACGTGGTGGCGCTCCAGACACTGCAGGACTTCACCCGTTGGGCTAAGGCTGGTGATCTCC
TGCCGTACAAACCTgccaacttctccaaggTCCACAACTCGTTGAAGGACAAGAATGGCGCGTGGCTGGCGTACTCCATCTACCAGTTCAGCTTCATCTA
CAACACGACTGCCCTCGACGGACTAACGCCACCAGCCACCCCGGCAGATCTGGTGAAACCGGAATATGCTGGTAAAATTGCTTCGTCGTACCCTCacgat
gacgacgccgtTCTGTTCCTGTACACTCGCtacgtggagaagtacggGTGGGACTGGGTGTCTGGCCTCGCTCAGCAGAACGTCAGCTTCAACCGTGGTT
CGAATGTCGCGGGTGAACTTGTGAGTGCTGGGACCAAGGCCATTGGCATTGGCTCGAGTGTCCGTGGCAACGGGACCACATTTGTCACCAACGACACGGA
GTTCCTCGGCTGGGGTCAGCGCATTGGCATTTTGTCGAAGGCCAGGCACCCAGCTGCTGCCAAGTTGTTCATGAACTGGATCGTGTCTGAGGAGGCCCAG
ACGTCGGTGGTGACCAACAGTGTGCGCACGGACATCAACACCAACAAGCCCTGGGACGTTCCGGAGGCCAACATGGCCAATTTCCCTGCGTTCATGGAGG
ACCGCGCGAAGgtggagcagtggaagcaAACGTTCGCGTTGTACTTCGGTGAGGTTCAAGGTAAACCGTCACCTGGGTGGCTCGGTCTTCACCCGGGACA
GTAA