Description :
From Genome Similarity Track
Location :
Scaffold_10:357386- 360457
Transcript NameFunction/comments
Physo_340793Eukaryotic/viral aspartic protease, active site

Sequence
3071 bases(100 bases per row)
GCTTGGCCGGCGATCATTTCTCCTCTCGATCAACTTCGATCCCGCAATAGGAAGCGGCAAACAACTCAAGAAAGGAAGGAACACACCCGGAAAGGCAACT
ACAGGCCTTGGATCTACTCCAGACCGACCGATCGCAGCGAACAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGACTACCGCGCTGCTCCACA
AACTATCCCCGCGTCACGCCAAGACATTCGATCTTCACCAAGTGCTGCATCTTTGGAGCCCCGAGAGAGCGGATCCAGCCCGCCGACGGGTACACAAGGT
GAGAACAAGTTCAGCCGATCACAGATCGTTGGGGGGCCCCCTCCGTTAGTCGGTGTCTGGGCGCTGGTGGGAAGCTCGGTCAGGGCTTAACCAGATTTTG
GCCGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTCTTGGGGACTCCGGATTTCACCGTAAGTCCGTAGAAGATGCGCAAGTGAAGAAAGAACC
AGGGGAAGAGGCGTCGACGGATATTCGGATCAACGAAGACGCTGCTGAACAAAACAAGACCCGCGGATTGACAGAGTGCTCGGAGGACTTCTTTCGACGA
AATCGAGGGCGATCTGGAGACAGATCTAGAGGACAAACCTCAACATCCTCCCCAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCAAACCGAGATTCA
CTAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCCGACTCGCCGATCAGGCTCGATCCGGACTACCTGGACGCGATCGCGGACAAGGACG
AGATCGTGAGGAAGAAGCCGAAAGCGCCAGGCTTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTCCGAGGCTGACCTGGATCGTCAGTATCA
CTTGAAGGAACTGCGAGACTTCTTGCGTCAAGATCCTGTCATGGTGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATCTCGGCCCCCCGA
GTGACGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGGTTTCGTGGCTGGCGCCTATGAAGCGAACGGCCTTTTCGATC
AAGATCTCGATGTGATCCAGACTGTGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGCGGACAGTCCGGACCTGAAGGTGCCAGT
GCTAGTGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCGACCGTCGTCTCCTTATGTCTTCGCAGCGGAACATGTATCGGATACG
TCGTCCGAACCTCAACGGATGCCCCTCGGCCCTTCAGGATCTGTGATGTTGGACGCACGATCACGGAATCAACGTCAGGAACGCATGCGATCAGGACCTC
GGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTGCTACCGGATCAGATGCGTCGAATAACAGACTGGATTCTTACTTTCAGGCTGCGATGGCTCG
ATTTCTGAAGGAACAACAGGCCACGGTGGCAACACCTACTCCAGTGGTCGACGACAACGTTGGATCGCGGGACGTGGAGATGGAATCAGCCGGATCGCCG
GATCAAGATCCCTCTCAGTGGGAATACGATCTGGACGACATTGATCTACCGAGTTCGGCCCCTGCTGCGGTGGTCACCGCTGCCTCAGGATCCACTGGGT
CCTCCTTAATCCAGCGTGCGCGGATTTCGGCGATGCCCGATCTTAAGGAGTTCAGTGGCAAGGATCAGGACGAAGACCGCGCCCGATCGTGGACCAGCAA
GGTGAAATCGGCGTCCCTGCGAGATCAGGCTACGGACGAAGAGAAGTGCCTGACCTTCGCTGATCAACTGACGGGCCCGGCGAAGAACTGGTACCGCCAG
CTGGGCCGATCGACGCGGAACAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGCCGCTTGGCAGTATTACCATT
CTCGCAAGAGATCATATGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGCTCTGTGTGCGAAATTGAAGATCAAGGACGGAGATTCCAAGGC
CCGCCGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGACCTGGCCGATCGGCTCACTATACTCCGGCTTGCGGACGCAGAAGATCTGGAG
GAAGTCCTGCGCGCTCGAGAGCGCGCGAAGAGCAGACAGAAGCGATCTGCCTTTGAATCGAAGTATCTTCAGAAGGTTCTGACCTCAGCACCAGCTGCTG
CAACCAACCGGGCAGTGCGTGCAGTGCAGATCGCGAGCCAGGAGTCTGGATCGGACACGGGATCAGACGGATCGGACTCAGAGGGTGATCTACGTCGCGT
TTACCTAGCGTCGGCCGAGGACAAGTCCCGCAACGCTGGGGGCGACGCGACGAAGCCGGATCGAAGCAACCAAGCGCAGATCAACCATGACCCACCTCGA
TCGGATCCACGATCGCTATCTTCACCTGACGGCTCGGAGCGATCAAACCGCTGCTCACATTGTGGATCGCGGAAACACACCGATCTCGATTGTTGGAGAC
GTTTGAGGTGCGAGAAGTGTGGCAAGAGAGGTCATCCGACGGATCGCTGCCTGTTTGTGTGCCGTGGATGTGGTGAACTACACGAGATGGGCAAGTGCCC
GATGGAGGAATTCAACAACCAGATCCGTCAATGGTGTGAAGCACGCTGGCATGTTGCCCGCGATCGACGAGAAGATGTTAAACTAGGACGCTCGCCGGGT
TGGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATCTATGCATTCGTGAACAACAACACGGTAGATCGAGTAAGTGGACGGACTGATCTACGCGGTA
ATACATGTGATCTGCATGCGAAATCTACCGCCAAGGTCTTAAGTCTACATCGATCGGACGACTTCAGCCGTTCTGACGCCGAAGTGCCCTTGGATCTCCA
GTCTGGAGAAACGCGGGGCTATTGGAAGCAACTCAGACCGGAAGAATGGTTCACGCCAGCTGATGGAGAAG