Description :
From Genome Similarity Track
Location :
Scaffold_7:357320- 365357
Transcript NameFunction/comments
Physo_337767Hypothetical protein

Sequence
8037 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTTCGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCTCCATCTGAACGACTCGCAGTTCGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCTCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGGCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGGGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGAGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCCACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGACTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCACCCA
AGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGACTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGA
CTTAGCCCCTGAGAGGCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGATGGACTCTGGGGCGTCCAACAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGTAAAGGCA
ACGGACTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGGTAAGTTAGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGTCCAGCCATCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGTAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCTACACACGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTAGGTAACCATGTTCCACGCGCG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCTGATGTGGGTAACATAGGCCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAG
CCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAA
CAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGAC
GAAGATACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCG
AAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCT
TGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGATTCCACGTCGGCCGCGTTGAAC
TCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCCCGTCGCGCATGGACTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGT
ACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGG
CACGAAGTACTGTGTCACGAGGCAATGGGCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGG
GAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAATGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAG
TGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTATGC
GCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTT
CAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGTCGTACTTTGACGGCATCCTCGTCCACAGCCGTGCCGAGGCAGGCCAGACG
GCCATGGAGGTGATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGA
GATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAG
GACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATG
TCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCC
TTTCAGCGTAGTCTGTGATGCGTCTAACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGG
CAGCTCAAGGCAGCCGAACGGAACTGTCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGA
CGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGA
ATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTC
ACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCCGAAGCCAAGGCCG
AGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGTTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTACCCGTATTGT
CGTGCCCAACGACTAGGATCTCAAGTACGACATCCTGATGGAGGCGCTCGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGCACGCGTCTGTC
TCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTACCAGCGCGTGAAGCCTGCCGGTCACGCCTCGG
CACCATTGCAGAGCCTGCTGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGT
TGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACATTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTC
TTCCGACACCACGGTTTGCCCGAGACCATTGTTTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGAC
TGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCTGCAGTATCTGCGCGGAGATGCC
CCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGC
CACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGA
GTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGTCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACA
GAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATATAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTT
AGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGA
TGACGACTCACCCGACGTTTTACGTGGGTCGTGTTAAGAGGTATCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAA
GAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGATGGCGCGGCGTACATCGGAGCAGCATACGCAG
GGGCCCCGTACGAGCCCTGGCCAAACTGGGTCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGC
GAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATTCTCA
CGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGACCGACACCAAGCGCGATCTCGAGGACGTACACACAGTACCGGA
GAAGACGAATCTCCTCTTGCTGCAGGACCACCACCTAACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGACTCGTAGCCATGGCCGTGTGAGGCCAC
CGCCGGTCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTG
GAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAG
CTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCTCGCTCTTCACGAGCTTTGGCTCTCGCCTC
TTGCTTCAGCTCGGTCATCTTCGGGCGGAGCATGCGCTAGCTCACGTATTGAGCGAACTCGATGCGGAGCTCGCGGGTCCAGGATAGCGGACAGAGTGCG
ATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCACGCTCCAGGTCATGTTGTCATTC
GGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTTCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTG
CTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGAT
AAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGAACGTGGCATCCCCGCCTGAA
GAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCT
CCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTT
CGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGATGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCC
TTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGG
ACTCGGCGTCCTCCGCATCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGACGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGT
GCTACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCC
GAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTAACGGCCACTCTCCGGCGTGCTGCTACGTGAGCGCACCACCTC
CTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCTTGCGGTTTCGGAGGTGCTTTC
GCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGGGCC
GATGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAAT
CTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTGCATCGGTCACTCCCCTGGATAGTGACCCAAGTGG
CCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAAGAATTGTATGCAGGCCAAATCTGTACCAACCTATAAACACATTCAGTCT
TAGATCTACCGCTTTTCAAGTCAAGCCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGA
AGTGTTGTGCCCCGTCACAGGTTTCGACCCACAATAT