Description :
From Genome Similarity Track
Location :
Scaffold_28:35727- 37211
Transcript NameFunction/comments
Physo_133786hypothetical protein

Sequence
1484 bases(100 bases per row)
TCGTAGCCCGAGGGGCAGTACGGGAACGTCTTGTCGCTCACAATGTTGAGGAAGAGGTTCTTGCCCGTCGTGTACGTCACGTAGCCGCCGAGGCAGGCGC
AGACAACGATGATGAAGGCACCAATAGCCTTCTCGTACCACGGAGTGCGGTTCCAGAACACCTTGAGGTAGAAGAAGATCGGCAGGATGATGCAGGCCAT
GGACACGGCCCAGGCACCGACGAAGTCGGTGAAGTCGACGAAGTGGTCCTTGAAAATGATGGCGATGACGAGGAGGATCACCACAACAACGATACGGATC
GTCATGTACTTGGCGGTCACGATGGGGCCGCTGTTGTGGTACTCATCGAGCAGCGCCTCCGGAGACAGGTCGTACTCGGCGTCAGCAAGCGACGTCACGG
ACGGGCCCGTCACGCCGATGGCCGAAGCACGGTCCTTCTGCGGCGTGTTGATGCCCTCGAAGGCGGGGGACTCCTCGTCGACAGCAGCGAGGAGCGGACG
CTTGTGCATGCCCAGAATGCCGCGCTCAGCGATGTAGAGCACGGGGTTCAGGATCACGGACATGGCGATGGTGATGTGCAGCTGCATGAACAGGTAAGCC
AGCACAACAGCACCGCGGTTGGCGTTCAGGTCCAGCGCCGTGCCGCCGATGGCGAACAGCAGGTTGCCGGGGATCTGGCAGCCCACGAAGGCGTACGAGG
TCTCGCCGATGATGAGGAACAGGCACGCGGTGAAGGCCATCGTGGTGGCGACGATGCGCGGCATACGCTCGGGCTGCGAGTGCTCGCGCTGCAGAGCAGG
CACCAGTACGGCGGCGGAGTAGGCCAGAGCCAGGTTACCGAAGGAGCTGGCCACCTGGCCGAAGTCGAAGTCGGGGTTGATCACGGACGGGTGGTCCGAG
CCGATGCCGTTAACCAGCACGCCGAGAGCGATGGCGTCGGCCAGGAGCGTGCCCAGGCAGCCAGCGAAGGCAGCAGCAGCACCTTCCTTGAGCGTTGGGG
TGAGGATCACAGGCATCAGCATGGCGGCCATGATGATACTCCAGTACTGCTGGTCGAAGGCACCGGGGGAGATGCCGTCGAGCAGGATACCACCGAGCAC
CAGGAACGCGCACGGCACCAAGCAGCAAACACCGAACTGGACGAAGAGGACGACGTAACGGCCGATCTTGCCGCAGCACCACTCGCCGACGTCACCGTAG
GTCTTAACCGACTTGGGGGCGGCCAGCATGACGCGCGAGATGGCCACGCACGAGCAAATGTTGGCGAAGCCCATGAAGATAAGCGCGATCGTGGCGATCG
TGGCGCCCGAGCGCGCGAAGTTGGACGGCAGGCCTAGCGTACCAATGCCGTACACGGTACAGAAGAAGTTGAAGGCGATCTTGAGGTCCTCGGTCGTGAA
GAACGCCATGTTGTCGCGCTGTTTAACGAGCGTCTCGACTCTTGCGTTGAGGGGGCCGGAGCAAAACGAGAAGTGGAGTGGAGG