Description :
From Genome Similarity Track
Location :
Scaffold_991:3572- 5094
Transcript NameFunction/comments
Phyag_g9019hypothetical protein PHYSODRAFT_495612
Phyag_g9020hypothetical protein PHYSODRAFT_249642

Sequence
1522 bases(100 bases per row)
GCGTATCTTCTGGAGGAAGATGTCGATGGTCGACAAGGGCgtgtcgatgctggtgatgctCGTGTGTGGCTGCGCCGGCTTCTACGTCATGATTCACGCG
GCCAAGGAGCTCTTCACGCcgtcggacgacgacaccgcGTTCCCGTACTGCGATCTAGAGTTCCAGAATGAACCGTATTACATCCGCAACAACACCAGCT
AGGCTGCAGCATTGTACGTGGCACAGTGGTATTAGTATAGCATAGCGTGGTAGGGCTAGCTCGAAAGCTCGGCTCATACCATAAACGAAGACTTTAAAAA
TGTAGCCGAGCAGTGTTTCGCTGCGCGCACGAGTTGTGTTGCTTTGGAAATTCACTGAGCAATGGGTTGTTGGTGACACCGCCGCGTCTAGAATGCGTGG
AGCGCGCGTTGCCGAGGACTGCAGTTCTTCGTCTTATCGCTGGATAGCTACATCCGACGTTCCTCGCCCACGTTCGcataaataaataaaaatTTCCCCA
CCGCCAGAACGCCTAGGAGCAAGTTTCACCGTGCAACCTGCGCTCCAATGCCTTCCCAAATTGTCTAGACAATGCGAACGAGACAGTCGAGAGTGCCTCG
TCACAGGCGAGGAGGATGGGAGGTGCCCATCGCGGTGGTAAGGCACACTGACAGCCATCCTCATCAACGAGCTAGGTAGCAGCTACGCGTGGAATTCTGC
ATTAGATCGAGGCGCTTCGTTTCGCGGACATCGGTAACCTTGAAAGGCTGTAAAGCCCTCCGTGGTTTCACCGTCTTTGTCGCTTGCAAAGCAGTAAGCC
TTTGCAAAGCGGCATGCGCGTTTATGTTTTCCCTGGACTTGTGCCTCGGGTTTgcttgctggagcagcgagaagagcagcaccacaCGCGCTTTCTTCCG
TGGCGTCTATTAGCCAAGTCTAAACATTCATGCTGATGCATCTGACGAAAGATGAATGCTATGAAGCATGATAGAGCGGCGACCAAGCTGTCCATTGTAC
CGCGCCAGTTCTCCCCGTTATCGATTCACTTCCTCTGGCAGaacacagcagcatcaagaTCTCGCTTCAATCCTTGTACAGTTGCAACACGATGTCGAAA
TCGGCTTTCGTCACGATGGACGACGCTAAAACGGCCTTCAACCTCTTCTGCTGTGTCCTCGGCATCGGATCGCTCGCTATGCCTTCCAACTACGATCGCG
CTTGCCTTCATGATGCTTGCAAACACGTATGCAGCCATGAAGCTGTCAATGGTGATGCTGGCCACTCCATCCTCAGTCAAAACCTACGGCGATCTCGGTG
GGCAAATGGGGGCGCTTCTTCACTGTGGTGTCACAAATGGTCGTGTGTGTGCTGGTCCCGTATGCCTTCCTCATTCTGGGTAGTACACTACTTGATGTAT
TGTTCTCGAACTCGTTCAGTCAGACATTCTGGATCGTCTTCATGGCTCTCATGGTGATCCCAGTTTGCTTCATTCCGACGTTGAAGGAGAGCGCTGGTAT
GGCTTTTGCCGGCTGCATGGGC