Description :
From Genome Similarity Track
Location :
Scaffold_1:357127- 365847
Transcript NameFunction/comments
g117.t1ETI40509.1 hypothetical protein F443_14123 [Phytophthora parasitica P1569
g118.t1hypothetical protein
g119.t1RAW37422.1 Histidine--tRNA ligase [Phytophthora cactorum
g120.t1RAW37424.1 Chromodomain-helicase-DNA-binding protein 9 [Phytophthora cactorum

Sequence
8720 bases(100 bases per row)
TTCCTCGCGTCCATCTGTCCTCAACAGCTCTGACTCCTTGGCTCGGAAACGTACAAAAAATTGCATCCGCGTCGCTACCGCTGGCCGCAGCAGCCGCCAC
AAGTTCGTTGGGCAGGTGCAGCGCTCAACTCTTTCCGCTCGCTGCGGACCAGTTTTCGTGGCTGAAAGGACCCCTGTCGTGCCGAAGCCATCCCAAACGA
CCATGGCTGTCGCCAGTGTGGTCGGCGTCGAGGACTGTCGAAGCGCGAGCATCTTGACATCGACGAGCGTGTACGATTCAGTCATTGATCAGGAAGCCGT
GAGCGAAGACGAACAAGATCGCGCCTCCGTGGAGAGCGTGGAAGCTGAGATCGAGCCGGAAGAAGCTGAAAAGGAGAGCGACGAGACCGAAACGTTGAAG
GAAAAGTCGAAGGGCCTCTCCGCAGACGTGCAGCTGACGGAGGAAAAACCCGCAGCTACTAAGACGCAGGACGAGCCAGAGTTGGAGACGCCGAGCGACG
ACTCGTGGAAGGAGAAGCAGCAGCAGCAACGTCCAGCTACTGCGAGAAGCGCCGAGTCGAGTTCTGTCACTCGCCGTCCGTTTGTCCCGTTGGCTTCCAA
AAGTTGGCGAGTGCGTGCCATGCAGTCCAACACGCAGATCACGCGCCTCATGAAGGCAGCGCTGCTGCAGACGCTGCTGCACGCTATCCGCATCGGGTCG
GTGGAGGGGGTGAAGGTTGCCATTGAGCGTGGAGTGCAGGTGCAGTACCTGGACAGCCGCCAGCGCAACCTCGTCATGCTCGCCTCCAAGTGTGATACCG
ATGCTCGTCTGCACATTGCAATCATCCTGCTGGACGCCGGCTGCGATATGAACCACACAGACCAGCTTGGCTGGAGCTGTCTGCACTATGCTTGGTACGG
TCGATGGACAGGCGCCACTATGCGAGGAATCTCTTGTTGCTTGTTTTTGCTAACGATTTATTGTATTTAATTTGTGTGTATGCAGCGCTAGTGGTGCCGA
CGATGTCGCTGCTGAGCTCATTCGTCGCGGAGCTCGTGTAGAGTTCAATCCCTATGGATACGGCCCTGAAGACTTCAACATTCCCAAGGTGGCACGTGCA
AAAAGCCTGTTGCAACACACGGAGCAGCTGCAGCATGAACAAAATGTCTGTGCGGCCTGGACATTCTTCCGCCGCCAGGCCGAGAAGACTGGTTACAGCG
TCAAGTGCAAATCGGTATGTGGATGGCTGTTCCACCCGATGAATGCTGGACTAGTTCATGACAACTAACTGTGCTTGGTATTACTTTTCGTAGAACTGTG
ACCTTGGTAAGCCTATGAAGATCACATTCCAGGCTCCAGCTTCGCACAGCCCGCTGGACCGCATCCGTGTGGTCGACATGAACTCTGATGTAGCTCTGTG
GCTGCAAGTATCCAAGACTTTCAGTATTCCTCCTGGTGAGGTGGGCACGATTACGTTAGATGTGGAGACGCTGGATCGACCATCACTATATCGCATCGTT
TACGAGAAATATGAGCCGACACCAATTCAGCTCCCGGCATCGGTTGCTGAAAGTAACTTGTGCGTGAAGAACCTGGACACTGGAACGACAGTGTCGATGG
GCAGCATCAACAATTTGGTGCTCAAAGAGTTAAAGAGCTCACGATCAGCAACGAAATCGAGCACATTGTCGAGCTCGGCCAGGTAAGCAAAGATGGGAGA
CAAATGAGTTATCATCAGTTTGTCCTCACCACCAGTATGAATTTCTGTCTGTAGACCAGCACCGAAGTCGGATAAATCTGTCAGCGTCGTGCGAAGAGGA
TCCACAACGTACGTCTCATCCCAGCTATAATGCTGCTGTGCCATTGGATTGACAATGAACTGTTGTTTGTACTTGTAGTCGGGCTCGGGAAATCAATGAG
AGTGTGCGTGAGGCTACGGTGGAGGAGGAGGAGGAAGGAGAGGAGGCTGAATTCTCAGCTGATGAAACGATAACAGCGCAGGAGGTCGCTGAACATCCAG
CTGTCACGAGTATTACTGGCGTATACAAGATCGTGGCGATGAGTGCCGTCAGTGTTTCAACACTGCGAACCGCCAAAGCCAACGAGTACGAAATCTCTAT
TCATCGCAAGGGCCCGCTCGGACTCCAACTGGTACGATTCTGTCCTTTTTAAGGAAGTACAATCTGTATATCTTACCATGTCATTCCTGGTTTGCTCTTA
GGCACCCAAGCTTGATGGCTCCAAGAGATCACCACGTCTCATCGTACGACGCAGCCAGGGTCAAGCGGCAGCTGTGAACCCGGGTGATTGCCTTGTTGCT
ATTGGCAACGCAAACATTGAGCACGCAGGCCTGAAGCACACGCTGTGGGCACTGAACGATGCGAAGCGCCCGCTTGTGCTTCGCTTCCGACGTGGCAATG
CCAAGGAGAAGAGGAGTCTGTTCAGGACTGGGCTATCTAAGCTTACAGGCCCTCGTAGGCAACCGATCATTGCTGTGTAGGCGTGGTTAGCCCTTGAAGG
TGCAGTTTTTATTTTGCATAGGTTTTGATAGGATTAATAGACAAATGTTATGAGGTCTACGCGTGTAACTATGAATCGATTGAGCGATCTGAGGTTGGGT
GGCTTGCAAAGTGAACCTGTTTGACGTCCGTCTACCTTTGGTTTGACTTCGGTTCATAAACACTACAGCATCGGGTGACCTTTGTCAACATGACAATACT
TGAACGTCCTGTTCTGACTAGCGCATCGCCGGCATAATGCCCCGGGCTTGGTCGAAACATCGATAACATGGAGTGGGTGTGCCTGAACAAAATAAAATGT
AATGAAGTGATAAGATCAGAGACCGATAGTGTACAGCGATAAATGGAAGTGATACCTTGAAGTGCTCCAGTAGATCGTCTGGATGGACCTCTGTGCGAGT
ATTTGTATCGGGATCGTACACGATGGCAGGGTCTGTACCAGTACACAGTTCGTTAGCGCTGTACTGCCACATCTCTAGGAGCAACCGCTGTCAATCCTTA
CATTGTTTGCCATCTCCACGCCATATGTACCAAGCTTGTGCCTCCCACCACGCGGGCTCCATTGATCCAGCATTCTGATACTATTCGTAACAAAATCATC
GATAGAGCACGAGCATCATCAGCATGAATCAAGAACAAACAGAGAAAGCTTACAGCAACTTACTGCGATCGTTAACATCGATCCCGGTCGTAGCGAGCTC
GCCCACGATTTCACGCGTACCAAGAAATCGGTGGGCGCTTTATCTGGCGCGTACTTCTTCACCAACTGCCACTCGCCATCTTTTCCGTTGCCGCGCCGCT
GAAGCCACGGGTTGTGTCCATGAAACGACCACGTGTTCGGCAAGATGATGCGGTGCGGCTCGTTCGGGTTCACGTAGACAATGCCGAAAGCCCAATGCGG
GAACTGCTGCCTCATCGCACCTGTTTTGTAGCCTGTGTAGTAGACGAAGAGCTTGTGCACACACGTCATCTGGTTGTGCATGAACTCCGACCACGACTCC
TTCGCCCTAGGCTTCTCCTGCTTCAGTAGGTTTTCCACTTGGGCCTCGGCCAAGAACTCTCCGGTCGCCTGCTTGGCCATAGCCTCCACGTCGCGCTTAA
ACGTTCTGTTCGTCTGTAAGCAAGGAACACCACACGTCAGCACCGCCACACAACGACCTAGCTATCTTGACTTCTACACGCACCATTCCTAACCTGCCGA
GCGCGACGGGCGACAGGAACGCTGCGACGCGCAGCTTGAGCTCGAAGCTGATCTCCTGAATGTTCGTCACTTTCACGTATTTGCGCATCCTGACGGCGAC
TGCGGCGCTCTCCACTCGACGCTTCTTGGCGGCAGCTTTGCCCGCCAAGTTCTTGTGGAAGTAGGCGCTCTCTACGCGCAGCATGCAGGAGCACACTGCG
CGGCCATCGCAGCGGCGCGTGTGGCGCACCAGATTGGCATCCATTAGGGACTTGGTGGGGCTCTCAACCGCGGCGGCCGTCGTCGTCTTCTCCGCGTTCA
TCTCCATCATCGGCGTCGTTTTGGCGTGTGGGTTGCAGCCGCAGATGAGCCGGCGACATTTGATTGGCTAAAACTGCGATGCAATATGCTCCCATTTCAT
TGTCAAAGTGAGGGTAGCAATGTGGGGACTTCGGCCGCGGACGGCGCGTGCGCACGCGTCTCGCTCGCGGCGCTGGTTGGCGGTGGCCTCTAAGGCGAAG
GCCATCAGCCGTGTGAGAGGCACCAGAGATTTACTGGCGGATGACTCACAGCAACATCGCCAGGTGCTCGACGTGCTGCAACGTACCGTCGAGCGCTACG
GATTTCGCTCGGTGCGTGTAAAGAAAGCGCTGGTTTAGTATCTGCTCTGGTTGTTGCACTGACGAATTGGTTCGTTATTTACTTGCAGATCCAGACGCCG
TTAATAGAGTACACGGACCTGTTCTCGAGATCACTGGGTGACGGCTCCGACATCGTCATGAAGGTGCGTAACAGACGAGGAGTCTGCAGTGAGATGTACC
TGATAGGGCTGGCTGCGTTTGTCACTGCAGGAGATGTACACTTTCGAGGACAACTCGGGCAAGAGTGTGACGTTGAGGCCGGAAGGCACGGCTGGTACGT
TCCGATGGTGCTTGCGTCGTGATCGCAATGGCAGCTTTTGCTTGACTGAATGCGGTTCTTGTTGTTGTAGGTATCATGCGAGCTCTCGTTAGCAACAATA
TGCTGTTCTCGCTGCCGCAGAAGATCTCGTATTCGGGCAGCATGTTCCGGTGCGTGAGCGATAGTAACGTTGTTAGCTAGATCAGCGAAAAGAGCTTCAC
TGAACGTGTGTTGTTGGCACTGCAGGTACGAACGTCCTCAGCGCGGGAGATATCGTGAATTCCAGCAATTTGGTATGTTTCTGTGGGAATGGTAATTATT
GTGAAAGAACAATTGAATATTAACCGCAAACTTCCAGGTGTGGAGTTTGTGGGCTCTTCGGGTCCATCGGTCGACGCTGAGATCATTGCAATGGCTACTG
ACGCATTGGATGCCCTGGGTATCAAGGACAAAGTCGTGCTGGAGTTGAACTCTCTGGGTGATAATGAAAGGTGTCGAGGGCGTCATTCGCGCTTCTGTAC
CTTATTCGGTGTGATATTTGTTTCAAGCTAACCTTTTTGTGGTGTGGTCTCCAAACAGTCGTGCAAGATATCGTGCTGCGCTGGAAGATTTCTTTTCCAA
GTGCAAGGACGACCTGTCATCGGATAGCATTAAGCGGTCCGTTAGCTGTGTCTGTCCTGGGCTATTATCTTGTGTTTGAGTACTAACAATGAGTTTGCTC
TACAACTGTTTTAGTCTCGAAAGAGGAAGTGTCTTGCGAATCTTGGATTCTAAAAGTGAGTGTGACCAGAAGATTATTGTTGATGCGCCGCGGCTCAATG
ACTACCTCTCCGATGAAGCCAGGACGGTAGGAACTGCTTCAAGCACATATTTAAAGTGGTATGCTTGCCGCAATACTTACGCTGTCTACTTTATGGTCTT
CATGTAAGCGCTTCGAGAACGTGCTGGATGGTTTGGACGCCTTGGGCATCAGCTACCACCGAAATCCACGCCTTGTGAGAGGATTGGTACGAGATTCTAC
ATGATTGTATACTCGCATTCGATGTCAAGAAGAAATTGCTGACGATATGGTATTATCCGTGCTTGGATTTCTCACAGGACTACTATAGTAACACGGTCTT
CGAGTTTGTAGAAAAACCTTTATCAGGTGACGAGAACCAGGAGGGAGAAATGGGAAGGGGTATCGCTGTGCTAGCAGGAGGCTGCTACGATGGGCTAGCA
GAGTCGCTAGGAGGTCCCCCAACAGCTTGCGTGGGTTGGGCGGCTGGAGTTGACCGACTCAATCTACTTCGAGAGATGCCTACCAAGACAAGTTTCACCG
TAGCGGTACGCTGCATGCGTACGGCCATGGCAGATGTATTATGTTCGGCTAAAGTTGCTTTTGCTTCGTTGGTATGTTGCAGGTTGTCCCCGTTCTTACT
GGTGATAGTTCGAGCCGCGTGCTTCAGGAAGCCATGCGTGTCGCTCAGGTATGTCACCTTGCATGGATATTTGACGTGTTTGCTGAGTTTATTCTCTCTT
GTCTATTGCACAGACACTTCGTCAACGCGGCCTAACGGTTCACTTCTGCCATGGGCGTGGTAATATGAAGAAGCAGATGAAGGCGAGTATACAATTCAAC
TACGTGGGGTATCCATGAATTAGCTCTAACCGATTGTTTGTGGCACAGGCTGCTGAGCGCTACGGAAGCACGCATGCTATAATTTTAGGCGGAGCTGAGA
TTGAACAGCAGTGCGTGAAGGTGAAGAACCTGGACAAACGTGGGGAGACTGAGGTGTCGATGGAAGAGCTGGACAGCTTTGAGTTCCTCTGAAAGCACCA
CTCTGTCAGCGATGAACACAGCAGAAAACTCCCGTGCAGTTCTTCGATCAATAGACGACAACCACTTCGATTTTTTTTACTTTTTATCTTTTTTCTACAT
TTTCGAATATCGGTCGATTTTCGCCACTGATTTGAAATTTGACAAAAGGACCCCATGGAGACTTCCCCGGAACCACAAGAGTCTCAGGAGCTGGACGAAG
CTCCACTGGAACCCCAAGAGCCTTCGAAGCTTCTTGAGCAGGAGGTGGAGATGGAGACCCCACCAGAGCCCCAAGATTCTCCGAAGCGCCAGGAGCCTCT
TGAGCAGCGGGTGGAGATGGAGACTCAACCAGAGCCCCACCATTATTCGAAGCGCCAGGAGCCACAGGTACCCCAAGACCTGGAAATTTGGTGCCTGATC
GTCGGGATGGTCGGGACGGCTTTTCCTGTGGTCGTCAAGGGGACCGACCGTGTCTGGGAGCTGCAGAAGACGATCAAGAATGAGGCCGTGGAAATCTTCG
GAGACTTCAACGCTGCTCAGCTGCGCCTGTTCCTAGCGAAGAAAGAGAATGGTCAATGGCTGTCGGAGATGGAAGTAAAGGACATTGAGAACGGAGATAC
AGAGCCGGCGATGCCCTTACTGGACAGAGGACACCTGGCGTCCATGAGTCGATTGGCTGCAATTTTCGAAGACCGTGATACAGACGCCGTCCATATTTTG
ATTCCAGCACCCATGAAGACCTCGGATATTGAGGTGATTGCAGACATTACCGGCAAGAGGAAGCGATCGAATGGAGATGTTGAGACGATGGAAATTGCGA
AGGAAGAACTGGCCGCCCTATTTGATGTCTTGGGGAAGAGCACGCAGACTGGACACAATCTTATAACGACGTCTGGCCTGAGTGAGTTTTGGAAAGGATA
TGGAGGATTTCCATCATCGTATTTTATCCGCAGAGAGGAGGTGATGCTGTGGGGACTAGTCATGCGACTGCTTTCTAAGCGGAAAATGAGGATTGTACTT
ACGGGTTCTCTGGGCGTTGGCAAGTCGTGCTTTGTCGCGCTATTAAGCTTCTACTTGGCATTTGTCGAGAAGCGAAAAGTTCTCGTCGTGCGTCGTTTGA
AGGGTTTTTCTGAAGCGAGTTCAGTCGTTTTCCTCAATGGAGAAAGCTGCACTTGCATCCGGAAGACAAACCTCCCGGCGGCTAAGATCTCGTCACTTTT
TGACAGAAAGGAATTTCAAGGCTCTTTAATACTCATCGACGGGTATTCTGAAGTAGAAGTAGGCCGGCGGTTTGGCTTCTTTCCGTACCAACTCCTGGCA
ACGTCTGCGGACTACGAAGGCAATGATTCCTTGTTTTTGGTGGTGTTGCCCTCATGGCGGTATGGTGATCTGCTACACTATGCCAAATCGACGATAGACG
AGTGGAAGAGGTCAACTGGGTTTGATCAGAAGGGCCAAGAAGCTGTTATTGACCTTGTCGATGCCCAGTACTTCTACAGTGGTGGGAATCTCCGCGATTT
CTGCAGAAATCGCGACGATGTCAAGGACAGAATAGATGAGATATGTGGATTGACGAGCAAGGCACAGACGATCGACTTGGAACTTGAGCAGTATGGACAT
TACGTCATAGACTCAGACAACGAAGATCACTACTTGGGGGTTCGCAATTGGGTTTACCCGATGGATTCGGGGTATGCATATAAGCGTATTGGACGCTTTA
TGGGCATGGATACGTGTTTAGGTCACTATGAACTCTCTCAAACGCTCAACGCTGGATTTTCGGGTGCAGCCTATGAACAGTGCTTCCACGCTGCTGTTAA
TCAGTCCAGGAAGAGAGCCCCTGTCCAGATGGTGAATGTTGTGGTGAACTTTGATCCTTCGAGCTCAAATCAAAGATACGACCGAATTGAGCTGCACGAT
CGAGCTGTTGAATGCGAAGGAAAAACGCTTGACGAGTGCTTCAAGCACCTATCGATGCTTACTCCAGGAACGTATTGGCATCCCGACTGCCCCACTTTCC
CCGTTATCGATGCGGTAGTGGTGTGCGAGGCCGTTTTGCGGGGGAGTAACGCGAAAGAGACCATTATTGCCTTAATCGCCACAACAGTTAGGGACAAGAA
ATCGTTTGAGCATGGTGTCTGGAAGAAGCTGAACAAAGGGCTTGATGCTAACGAGAGCATCCCCAACGATATCCCTCGCGTGCTTGTCGTAGTGGGCCCC
GACGCCAGGACGTGTAAACGGTTTACGTTGAGCAACGCTCCCGCTCCGGACGATTTTATGGTGTGCTGCTACGACCCGCTCAATTTCTTGCGGAGATCCC
TGCATGCCAGGATAGCTTGA