Description :
From Genome Similarity Track
Location :
scaffold_314:35710- 40026
Transcript NameFunction/comments
g7170.t1 conserved hypothetical protein
g7171.t1 hypothetical protein PHYSODRAFT_532657

Sequence
4316 bases(100 bases per row)
TTCAACGTGCCCCAGATCTGTACCTCCTCCGCCTATGCGCCCCGAATCGTGCAGCCTGGAAGAACTTAACCGAGGCGCTTATCGCGGCTCAATGGACCCT
GGCCGAGAAAAGAGAGAAACAAGAAGAGAAAGAGGATAACCCGACCCATGCGGAAGTTGAGCCACTTTAGTGTCAAGTCTTGACTCAAGACGGCACGCGA
AACGCGTTAACATAAGGCCGTTACGATCCACTCATTCAAGAATATCCAGGCATTGAGCTGCAGAACTCCGCTAAAGTACAGCAGCTCAATGAGATGTACT
ACAGCGTGAGCTTCAACAGCAAAGCAAAGATCGTAACGAATCGGATTCGTAACAGGGCAAATCCTCTCTGACCAAGCGAAGCTTCCTCGCTAGGTTTGTT
GTGGGTATCTAATTGCAATCGGGCATGCCTCGAAGAATCTTCGACACCCGACTGGATACTCTTGTGTTGATGCCATCAACCACTGGAAGTGAATGAAAGT
GAGCCGAAGATGCGTTTACGGCAGGAAGAAAGCCGCATTGATATCGGCAATAAATTACTGTGCTTTTATATGGGGGCTCGCAGGCCGGCAGGCGTCCGTA
ATCACCCGCTGTCTGCGAGCCTTCTCTATGGAGGTACATGCTGTCGTTCACATGACCCGCTGGCGTTTGAGGGGGCCGCCGCATGGAATCGAAGGGATCG
CGCACCGCTCGGCCTCTGCGGCCTGGTACTTGGTCCATAGGCGCGTGAGCATGGCCTCCTCCTGTTTCCGACGGATGTAGCTGCTGTTTGCGGGCAGGTT
GGCGACTGCGAGGCGCTTTGGGGCGGCACTGGGCGTGCACTCGGCAAATAGACTCGGGTCCAGCTCGTTCAGGTACTCGTCAAGTCCCCGGATGAGCACG
CGCTCGGTAGGCTGCGGTTGCTGTTGCTGCTCGAGCTGGTGCTTTCGCTCGAGGAACTCCTGGATCTCCTCGTAGTAACTGCGTGATCGGCTGTCGTGCA
CGCCGAGAAGTTGGCTGGAGGCCTCGTCCAGCCCGCCGACCTGCGCACAGATATATTGCTGTACGTGGTCCATTTCGGCGCGGTACTGCTGCTCCTTGGC
GGGGGACGCGAACTGTAGGGGGCGACGTACGATGCGCCGCGGGGCCGGTGACGGCTTCAAGCTGCTGCTGCTGCTGCAGGACATGGTGCTGGTCTGCAAA
TAGCGGAATGTCACCGAGCTCCCGCGCCGAAGCTCCTGTCAGCCCAGAAGTCCTACGTCTGTTACCTGCGATGCGATTTGCCCCAATGACGACGCGACAA
CGGGCGTGACCTAGGTACCCTAGTGGATTCTTTTTTGGTTACCTACACCTTGGATATGCAGGTTTCTACAAACAGCGTTTGTATGGATATAGGAGAAGTG
ATGTACGCGTATTTAGACGGGAAATTTCGATTCTCAGGTTTTGTGGCGCATCATCTGGTTCTAAAAAACGGGAAAAAAGAGACGAATTTTAACTTTCCAT
TCAAAAAGTGAGCTTCAACTGAATTTCGAGTAAATCGGTGACATCTTGTTCGTGAGACGGCCTTGTGCTGGATTATTATCGCGCCACCGCAACAAAATGG
CAGGATTTTGGCTCGCTCGTTGATGCCACGCGGTTGGTCTTGACGCCAACGGTGATCATCCCGACGAACAACGCAACGAGTGTGGGTTCAACCAGTGTCC
ATTTATAATTGCAGCTCTGGCAGATCGGATCTGGGCGCGGTGCCAACGCTGTGCTTCTGCGTGTGACTTGCGATATCAGATGGAGTTGCCCCGCCTGAGC
TCCGCTGCAGTTGATTGGAAGGCCGCAGCCCAGCTTCCAAGGCCTTGTGCGTTTTGGCTTGAATCATCGGTTGATTCGTTTGTTGATTCCTGGCAGGAGT
CGCGATGGGAACTTGACCTTTTCAGTTACAGCTTCGGAGCTCGTGGCTGGTACAGACCACACTGAGATAGCCTTAAGTCGAGCTACAAAAGCTCATGGCA
CTTACACTCTACACTGTGGACAGCAGTGGAAGTTACTTATTGCTAGTCGTTCATCATCAAAATGTTCGCCTTGATAACTGAGACCTCCATATTACTGGTC
AAAACTTTCTTATTGGCTGAAAATGGAACTAGGAGGGGAGCGGTCCAAGTTCAATCATATTGGCGAACGCCTACGTCGACCATGACGGCGGACAGCGCGC
TGCTGGCCGGTGGCTTCCTGCTCTTCTCCTCGACAGTGGCGCTCTTCTGCCTAGAGCGTAAACGGCACCGCCAGCGCGTCTGGCGCCAGCGTCTCACCTA
CAAGAAGCTCTCGAAATCGTGCGCTTGGATTTTCCCTCTCTAGTTGTTGCAGACGCTTCCTAACCGTCAATTCTACTCCTACAGATCCGACCTGGGCGCA
TCCTTCGGCTTGGATATCGGTGCGGACGAAAATCCATTGATACCGTTTTCTGGTTTAACGTTGAGCTGACTGCGTGTGGCTGTAGGTGGCACATTGGCCA
AGATCGTGTACTTTGAGCGCTATGAGGCTGGCAACGACACACGCAAGCGGCCGCGCTCGGCGTCACTGGATGTGGCAGCTGGAGAGATGAACAAGTTCTT
GCGTGAGAATCACTCGTTCGGCAGTACGGGCGTGCAGGACGTGCGGCTGCGGATCCACGCCAAGTCTTTGAACGGGGTGCGCTGCTTTAGATACTGTTTT
GTGTCGTGGCTGCACTTTGGACTAATGGAATATTTGCGGTTTCTAGATCTTCCACTTTGTGCGGTTCGAGAGCAACAAAACACGAGACGCTATTGAGTTT
ATTGCCAACAACGGGATCAATCAGTCGCTCAGGATCTTGCCCTGCACAGGAGGAGGAGCTCACAAGGTTTGACGTATGGGGAATTGTATGCTGTGGATTC
ACGCTGACTAGAGAGTGTTGCTTGGTCGCAGTACGGACGTGCGTTTACTGAGATCGCTGGGATTGAGCTGGAGAAATACGACGAGATCGACTGCACCATT
CTGGGACTGCATCTGCTGCTCACGACGCTATCTGATGAAGTGTACACTTTTGAGGTATGTGAGGTCATACTGCATTGGCCGGTTGTATCAGCTATGAACT
TTTGTTGGGTGGAACGACTGCGATTCAGGTCGTCGATTTCAACTCGTTGGCAGCATCGCGGGTTAAAACCATCCAAACGGATACAGATGAGGACGTCTAC
CCGTATCTGGTGAGTGTTGGCTTGAGTTTTGATGTTGGGGCGACTAACTTAACGCATTGTTTGTGTGGTTGTTCGTTTCTATAGCTTGTTAGTATTGGAT
CAGGTGTAAGCGTACTCTACGTGAAGGGCCCGGGGGATTACGAGCGTGTGAGTGGCAGCAGCATTGGTGGGGGCACCTACTGGGGTCTCTGCCGTCTCAT
GACCCACTGCGAATCCTACGACGAAGCCTTGGACTTGTGTGTGCATGGATCCAACAAATCGGTCGATATGAGTGTGGGTGATATCTATGGTGGAGCGTAC
GATAAGTTCAAGCTCCCGGCTTCAACCGTTGCCAGCAGCTTTGGCAAAATGATTTCGACTTCTCGTGAGAGTGTGAGTGACGCGGATCTCGCTCGATCAC
TTCTGGTGATGATCACGCAAAATATTGGCCAGGTTGCCTTCCTGAATGCGACCTTGTACAAGACCAAGAATATCTTCTTCGTTGGGAATTTTCTTCGGCA
CAACAAGATTTCGTCAAGGACGCTGGCGTATGCAATTAATTTCTGGTCGAATGGAGCGATGGAGGCGCGCTTTTGTAAGCACGAAGGGTATCTAGGCGCG
TTAGGTGCGTTCTTGCGCCATGCCGAGGCAACCAATGCCCACGGGGAAGAATTCGTATCAGCCACACGAGGCTCGCGGCAGTCGTCCTAGATACGAAATT
TGCAGCAGTTTAGGGGGAACTACGTCGAGCGAAAGTTTCTTTGAATTAGAATCACTTTTGATTGTCATTCATCTTGAAAAGGGGTCGTCAATCAAATTGG
GGATTCTGGTGAAGGATTAACGTTATTCCTATTGAGCTTGAATCGGAGGGCACTTCGACGTTTCCACCGCCAGTAGCACACTCGAGATGAGTGCCATGCA
AGATTATGGGCCACATCGTGGCTGATTGCGCGTGGCTTCTCCGATTATTGCTGTTTCGCACCGCCAACGACATCCTAGCACCCAAAGACGCAGGAGTGAG
CCTCGGACCGAGGACCTCGGTCATCGACGTCTCTGGATTCCGTTGGTAGGCGTGGGCGTGCAATGCAGGAGCCTGTCACTTTCATTCTGCAAGTTCCTAC
CAAGTGACCAAGCACC