Description :
From Genome Similarity Track
Location :
Scaffold_1225:3571- 7896
Sequence
4325 bases(100 bases per row)
TTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTCGAGCC
TGATTTGACGATAATCCCACTGGCTTCTTGCTGGATCTGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCA
CGTTCACAGGGGCTTCCTGTCCTCGGACACTCGCCCGCGCTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGTGTCGTGGTTCGGACGACGTGTC
TGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATG
GACTTAACTCTAGCAAAGAGGTCCCGCGTCGCGGATGCTATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTG
ACTCTGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGG
ATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGAT
CCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCATCTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGT
TTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTGTAATTTGTGGCGGCAGACAAAAAAATCTTGTACTTGGACGAAACT
AACTTCAATATGTGGGTTAGCCGCACCAATGGATGGAGTGTCCAAGATACGCGTGCTGTGGACGTGAACACGACCAGCAAAGGCAGCAATATCCACGTGA
TTGCGTGTATTTCGCGCGATGGAGTCGAGTATCATGAAGGGCGGTTTGGTTCGTTCAATTGTGAGGCTGCGAACGGTTTTATCCGTAGTAAGTAGTGCAC
CATTACTATCTTCTGCATTGATGTGAGCTAGGTTTCATGGTTTAGAAACGGCCCGTGGTATCGAGCACGACGCTAAACCAAACATACTGTGTAGTGTTTG
TATAAATGTTATTAGAAGTGCAGGTAAGATGAAGATACTGTGATTACCAACGATAATAAAGAGGTTGTAGTAAGAATCATGATTCGAGATCATTAGAAAA
AAAATTAAGCATGATGCTGACCCAGATTAATGAAATTAAAGTATCGAAGCGCATATGAGCTTAGCGTTTATTTTTAATATTTATCCCACCGAAGCGTAGC
GGAGGCGGGAAGGCCAAAACATGTAGAACTAAACCTAATTTACCGCCGCGTAGCAGCGGCGCTCGGCTAGTGTTTAATACATGTAGGTCCTATAATACAA
AAATAAAATGATTATAATATCAGCACAATGTACCGGTACATGTACGACGAATTGAAACCCGCAAACCTTCCCCTCTCCAGCCACGTCGCTATTGTCGCAA
TCTGTGGAATAGTGAACCGAAGTGAAATAAGAAGTGGCTCCCGTTCGGGCCTGAGAGTGGTGTCTCGATGCGGCAGCCGCCACCAAATTCTCCTCACTCG
GTGGCTCCAGCAACTGTTCTCTGTAAGCAACTTCGATTACCGGTACTATTGAAAAACGCCCTGGAGCGCGAACGCCTTCTGTGAGAACGCCGCGTCACCA
CCACTCACGATCGGAGCGCCAAGATGAAGGAAGTTGCTTCGCTGCCCCGCACGCCTACGATGGCCGCCACGGCGTCCGACCAGGGACCCAACAGCTTGCA
CCTGCATGCCGACACGGAGCTTGGAGAGGCCGCAAGGGGCTCGACTGGCGCCGAGGTCGCCGCTGATATGGAGCTCATGGGCGCCACCAATCGTGATATG
TTCTCGTGGTTACTGTTTAACTCAG