Description :
From Genome Similarity Track
Location :
Scaffold_4:35708- 37638
Transcript NameFunction/comments
g3535.t1hypothetical protein
g3536.t1ETL94824.1 hypothetical protein L917_07298 [Phytophthora parasitica

Sequence
1930 bases(100 bases per row)
GAGTCCATCAACACGGCGGTGGCGATTGCAGCAGAGGAAGACATGGAGGCTGAAAATGTGGATGTGGACACCGCGTTTCTCTACGGCGACGTTGAAGAGG
AGCTCTATATGGACCAGCCGGACGGATTTGAAGACCAAGTCAACCCAACCAAGAAGTGCCTGTTGATGCAAGCGCTTTACGGCACGAAGCAAGCGGCACG
CCAATGGAACAGCAAGCTGAACAAGCACCTGGAGGGCCAAGGTTTCCATCGGTCAGCGGCGGATCCGTGTGTGTATGTTCGGCGTTCGGACTCGAAGTTC
AGCATCATTATCGTCTACGTGGACGACCTCATGATCTTCAGCAGGACGAAAGCGGAGATCGGTGAGATCAAGAAGGCGCTGAAGCGCGAGTTCAGCATCA
AGGAGCTCGGTGAGCTGAAGTACTGTCTCGGCATCGAGATCCACCGCAACCGCGACGACAAGACCATCATCATGAATCAGCGAGCGTATATTCAACGACT
CGCGGAGAAGTTCGGCGTGGAAAAGTGCAAGGCAGTGCACACATCAGCGGACAGCAACTCGAAGCTGGTGAAGCCGTCAGAAGACGAAGATTTCGTGCCC
AGGTACCCGTATCGCGAGTTGGTGGGGGCTTTGATGTACCTCGCAACTTGTACGCGCCCGGACATTGCTCAAGCTGTGGGTGAAGTGGCCAAGTTTTGCG
AGCGGTACAACAAGTCTCACTGGGTGGCTGCGAAGCGGATTTTGAAGTACTTGAAGACCACTCAGGACCTGGGACTCGTGTTCAACGGCGGGACTAAGGG
AGAGCTGATCGGCTACGCGGATGCGAACTGGGCAGGTGATTTGGACACCCGGCGCTCGACTACTGGCTACGTGTTCTTCCTGAACGGGAGTGCAATTTCG
TGGAAGTCGAAGCGGCAACCGACAGTGGCAACCTCGAGCACGGAGGCAGAGTACATGGCACTGTACAACGCCACTCAAGAGGCAGTGTGGCTGCGTCAGC
TACTACTGGACGTGGGGTGTGAGTGTGTGGGTGCGACTACCATTTTTCAGGACAACCAAGGTTGCATTGCGCTGGCCAAGAACCCAGCGTACCACTCACG
CACCAAGCACATCGACTTGAAGTATCACTTCTTGCGCGAGAAGGTGGAAGACAAGGTCATCGTGCTCGAGTACAAGCCGACAGACGAGATGATCGCAGAC
GGGTTTACCAAAGCACTGGCGCGACCCAAGCACCGCCAGTTTCTCGTCGGACTCGGCATGGACGCCTAAGACGCCAAGCACAGCGCATCAAGGGAGAGTG
TTAGAGGGTGCTGTGTGTGCATGTGCGTGTGTGCACCAGGTGTGGGTGCAAGGCGTGTGTGCGTGCGCGTGCCTCTACGCGTGTGCGGGGGGGATTTGTG
GCGGCGTCAAGTGCTCATGATGAGACGCGCAGGTTGCGTGCGCGTGAGAACAAGCGTGTGGGAGCGTGTCCAAGTGCTCAAGCGGCGTGGACATGCGTGT
GGGTGCATAGTAAGAGTTACATATGTAGGAGTAGGGTGTGCGTGACTTTGGTCATGCAGTATGGTGTAGTGGGTTAAGTGCCGGGTCTTTGATCCGTAGG
GTGTGGGTTCGAGTCCCCCACATGGACGTTTTTCTTTTTGCCGACAGAGAGCGTAGGAGGCAGGCTAGCAGCTAAAACTCACTCAATCAATCTCACTTTT
GGTTTTGCAATCTCGGCCCGAAGCCGTCTTCTAAGCTTTCAACTCTCCGCAGCTCGTAGCCCAACTTCCTTTTGAACCAAACGTCTGGTTCAGGATTGGA
ACGTCAAGCTCCTCTGCGACCACACTGGGGTCCAAAGCTTGCAACTGCTCCCAATGCGAGTGCCCAATCACGGCGTAGTCCGATCCACTATCGGGGCAGA
ACGGAAGCTCCAGCTTGCCATTCAATGTCA