Description :
From Genome Similarity Track
Location :
Scaffold_15:35702- 37171
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006554Similar to ABCC1: Multidrug resistance-associated protein 1 (Gallus gallus)

Sequence
1469 bases(100 bases per row)
TGCATCTCGCTTCTGGGCTTGCGCGCATCTCGCACTCTTTTTGAGGCCATGACCCAGTCGCTCTTGCATGCTCCGTTGCGCTTTTTCGACGCGAACCCGA
TTGGCCGTGTCGTGAATCGGTACGGAGACGACATCACGTCGCTTGACTTCACTGTCCCTATGTATGGAAGCAGTTTGTTCGCGACCTTCTTCTTCACGGT
ATGCCAGCTCGTTACTGCAATCTACGTGGTGAACTTCCTGGGGGTACTCATCGTTCCGCTTGCCTACATGTACGTGTCCGTTGCGTCGTTCTATTTGGCG
CCGTCGCGAGAAGTGTCTCGGCTCTTGAAAGTCGCTTCCTCGCCGGTCTTAAGCCACGTGACCCAGTCGGAAGAAGGAGCAATCACGATTCGCGCTTTTG
GCCAAACGTACATCGATCACATGGTCGAAGAGAATCTCAAGCGCATCACTGTGAACAACAGGGTGTGGTTTGCGGAGACCGTGACTGCGCAATGGTTCAA
GGTTCGCATCCAACTTCTTGGTGCTGGAGTCGTCATCGTCGTCGTATCTGCGCTTGTCTACCTTCGCGAATCGCTGTCACCAGGGTTGGTTGGGGTAGCG
TTCACGTATGCTCTAAGTGTCGATACCAGTCTTGCGCGACTGGTTCAAACCTGGTCCAGCCTTGAAATCGGTATGGTCGGTCCAGAGAGAATCTTAGAAT
ACGCGTCGATTCGTTCCGAAGGTAAGGTGAACGCTCTCGTGATCGAACCATCTGCTGAGTGGCCTCGCCATGGTACCATCAAATTCGACAACGTCGTCTT
CAGCTACAAGGAAGGCGCTCCAGCTGTGCTCAAGGGACTCTCATTTGATATCAAGAACAACGAGAAGATCGGCATCGTCGGTCGAACCGGTGCTGGCAAG
TCGAGTCTCACCATGGCGCTCTTCCGAATCAACGAACTGGACACTGGTCGGATCTTGATCGACGGCGAAGACATCTCGACCATGCCTCTGCGCTCTTTAC
GTTCCAAGTTGTCGATCATCCCTCAAGCACCAGTTTTGTTCAAGGGAACCCTCCGTGCCTACATGGACCCGTTCGACGAGTTCACGGACGCAGATATCTG
GTCGGCGTTCGAGAAGGTCGAGATGAAGGAGCAGATCGGTGCGTTGGAGAACCAGTTGTCATACGAATTGAGCGAGAACGGCGAGAACTTCAGCGTGGGC
GAGCGTCAGATGCTATGCATGGCGCGTGCGTTGCTGACACAGACCCGCATCGTGGTCATGGACGAGGCCACGGCGTCGATCGACCACGCGACAGAGAAGA
AGCTGCAGACGATGATCGATCGCGACTTCAAGGACGCGACGGTGCTGACGATCGCGCATCGTCTGGCGACCGTGTTGGACTCGGATCGCATCATGGTGCT
GAGCGACGGGAAGGTGGTGGAGTTTGATTCGCCGGGGAACCTGGTGCAGAACCCGAAGGGTGTGTTCTA