Description :
From Genome Similarity Track
Location :
scaffold_12:357004- 358220
Sequence
1216 bases(100 bases per row)
GTGAttaaagaagattacagtatggtgtaCCCAAATGTTTACGTGAtttcttatatgaagtcacatacaTTCTGCGTGAGATAGAATGCTGTTGCCTATT
TGGGTGTCTCAATTAGTGCCGAGGCctacgtgtctctgtcttttgcagtgggttacgtaacCCAGTTCCTTCTACTATAAACcttccaagctctcgaagt
TCAAGCCCTGCACAACCAAGATCTTCTTTAGTTAATGCTGAGATACAGCCTCAGCACACCCTTGATTTTTATAGCAGAAACCCAAAATTCAATATGAAAA
ACCTCTCAGAGTCTTCGGGGTGTTTTACATGTAGCCGGTAACCATAACTCAATTAAAATTCAATTGCAATTTTTCCGTCAAGGTATGAAGCCGTTTTTCT
TCCCTCCAAGTTGGGATTTTCGTTCACCCTCCACGCTAGTGattgcttcctcgtcgcacatgCTTGTGtattgtgtttgagggactgtttgtgaacagcg
ccctcttacacctggtagcactttGAGCGGTCTTTCCAACGACACTCGATTTTGGTTTGACGACGCGGCAGTTGTGCACGTCGCGAGCTACAGGTCAAGC
CATACTCGCGTACTTGTCCGAGTGACATGGAAGGAGTTGGGGTACTACTCGGGTTATCGTAACCGCAAATTGAGGGGTTAACGAATAAGATGTTTTCTCA
TTTGTCTTCGAATAAGTGGAGGGAACTTGAGCGGATAGGATAAGCCTTCACAGAAACTGCAGTTGTCAGCTTACTGTAGCCGTTTTCTCTGGATGACCAG
AAGAATGCAGACGTCAGTTTCATCACCACGAGATTATGGAATCGCGGAATCAGGTCGCGACCCCTCTGCGAGAACAACGTCCCTGAAACTGATGATGTCT
TGCTACCCTGGCGGGAAAACGTGCTTCTTTCACGATGATTTGTCAAGATATTGTAACAATCACTGCAAGGCAACTGCAAGACCCCTTGCAGCAAGTGTTG
ATCGCAATGTCCAACTTTGCAGATCATGCGAAGAATTGGACGTATGGGAAGCATTTAGCCAATCAAAAATTCTTTTCGAGCTAAAGAAGGCGTTTGAGCC
ACCACAGAGTGAGTTCCGTGCCCGAGCCTAGTTTTTGAAGCTTTGTCAAGGTCGTTACgacctacactcgtatttACAGCGTGCTCGCTACTTGGTACCG
AGCATCGTcgacgagc