Description :
From Genome Similarity Track
Location :
scaffold_1640:357- 2981
Transcript NameFunction/comments
Pl_100461hypothetical protein PHYSODRAFT_375482
Pl_100462hypothetical protein PHYSODRAFT_299492

Sequence
2624 bases(100 bases per row)
CCCAGTGTGTGGTCAGGTTGTCGCCCCACTACACACACTTGTTCAACGCCATTCTGAAGTGCCAAAGTCCTTTCTGCAAGCTACAGTGATACCGATACGG
AAAAAGGAGACTCTCCTAACTCGTTGGACTACCGTCCCATTTCGCTATTGAACACAGCATACAAGCTGATCGGCAGGATACTTGCTGACAGACTCCACCA
ATTTTTTCCAAAACTCATTAGCCAATCTCAACAAGGTTTCGCAGCATTGATAAAACCATCACGATCCTTAGATCCATCCTCGCAGGCAGCAGATCAGACC
CATCAATACCGTGGACGGAAAAAGCCATAGCACTCTGTCTCGATCTACGCAAGGCGTACGACAACTTGGACAGAAATTTCATGCAACAAGTGCTAAAACA
ATACGGCTTCTCAACCAAAATTTTTAAAGTGATTCAAGTGCTTCACTCAGGAACAACAGCAAGATTCTTAGTGAACGGCAAAACCTCCCACGAATGGGCA
GTGAACTCAGGAATACGACAGGGTTGCCCATTGGCACCATTGCACTTTATATTGGCGGTCGACACGCTAGGTCAAGCCATCAACAGACAACCACGACTCC
AAGGCATACTGATTCCAGGGAGTAACGGAAAACGCCACAAATTTTCAGCGTTCGTTGACGATAGTACTGTATTCATGAGTTCCGCTAGTGAACTCGACAC
TGTGAAGACGATCCTGAAACAATTTGGAGATCTATCAGGGCTTAAAGTGCAATCAAGTAAGAGTCTAATCGTAGGACTCAATACTGCTGGAGCACCGAAA
AGATGGCACGGATTTCCCGTCCAAGCACCTGGCGAACCTAGTCGCTGGGTCGGGAACACAGTAGCTATAAAGGAAAACTGGAAAATCCGAATGGAAAAAA
ACTCAACGACGACTACAAATAGCGACTACTATAGGCAACTCCATCGTTCAACGGATCATGCTGTTACACGTGGTTGCACTGCCAGGAATATTATACACGG
GGAAGCAATTCGTCCCACCCAAAGACATACTCAAGCAACTAGTGAACATTCAAAAGCAATTTGTATGGAATGCAAGCACTAGAACTACTCCATGCAAGCA
TAAACTCAACCCAGCACTTGTCTACACTCCAGTAAACGCTGGGGGACTAGGACTACAAGACATTTCTAGAGCGCTGAAAGCAACGAGAGCAAACTTAGCA
GAATGATGGCTCCAGGCACCGAACAATGTGTACTCATCTGCTTGGCATGCACTAGCGCACCCCCTCCAACCGACAACGGAATTCTGTTGTGCTTTTCGAC
CCACGATAACGGAGGTGATCAACAGAGCGCTAAAGGAAAAAGCAGGTTTACCCCGCATTACTGCACAAGGTCTCGGAAAACTGGAACTCTGGGAGGCGCA
AACTAAGAGTACCAATTTAATGGAAGGACAGAACGGTAGCAGAAGGCACCGACAAATACGAGACGACAGCAAAGACACATGCACCTGGATAGATGAAGAA
ACATTGCATTTCACAACGACAATTAGCCCGTGGCGGACACAACTTCAACAGCAAGCGGACTTCCTCCTCAGAGTACCCTGGGACAATAACGCCAATATCC
TAGACGAAAAAGGTAAACCCCTTCGTCGTGAAGACTATCCGAAGATTGAGCAGTGCAGAATAAGTGACGTGATTGTCTTCGGCAGCGGAGAAAGCCATAA
AGCCAAAGAACATAGTATCCTGATACGCCCACCTAGCACAGCAACGCTCGCCACACTACAAACATCCAGAAATGGAGCATGAACGTACTAAGAAGTGTAC
CATGGAACTTATGGGGATTCAAGACGGTACCTCCAAAACCAATTACGCTCCCCTCTCTACGGAATGAGAGATCCAAAATAGCGGAGACATGCCCACCATA
CCAGGCATCTGCACACACCCAGAACGGAGAACAGCCTTTCATCTAGCTCGCAATGAAGAAGGGCTGACTTGGAGAATCACGTGGATAGATAGAGATTTCC
AACAGCATGATGACTATCAGGAACTCAAAGCGTGGGAACGAGTCGAAGGAATCGCTTTCGCGGAAAGTCCAGAAACTACGCCATACCCTTGGAAGGTACC
ATGGCACACAACATCGCCAAAATCCTCCGGAAACAACGATCAAACACAGTCAAACGATACATCCCTGCACAACTCCAGCCAGTATTGGAAAAAATAAACC
GTAGAGCGAAGACTTCGACTTGGGGCAGAGCAGCACTTCAGCACAGCCCAGGCGAACAATGGGATCGCAATGGACTATTCACGGACTTCCAAAACTGGAC
AGTATACCGAATAGCAATTGGTGCGCTCAACCTACGCCACCAGGGATGGCCCGACGATAGAGCATGTCCAGACCCGGAGTGCCCATGCTCTATAGAATCG
ATAGATCACATCGTGTGGGAATGCAAAAAAGCAGAGAGCGCATGGATGACATGGGTTAACAAATGGATGGGATACACCACACAAGCAGACCAAAAAACAG
AACTAAGAACTGCTGCAGCAACCAGAACTGCGCCGCCAATTCAGACAACTTTCCTAGCCAAAGCGCAAAAATGCATTGGACGATGGACCCCGTATCACAC
GGAAGCCATGAAGCTATTATGGAG