Description :
From Genome Similarity Track
Location :
Scaffold_934:357- 2460
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_934-snap-gene-0.8Secreted protein
Pytir_DAOMBR486snap_masked-pir_contig_934-abinit-gene-0.12C2 domain-containing protein

Sequence
2103 bases(100 bases per row)
CGGGGATGCCGAGCACCTGCGGCAGCAGCTCCAGGTACGACGTGGGGCCGATGTAGTCGAGCATCATCACCTGCTCGAACACGATCACGCCGATCGCCAG
CGGCTTCTTGGAGAGGGCAACGGCGGCCATAGCGAGCTATTGGGTGCTGAAAGATGGAAGCTGGTGGCGTCTGCTATCAGGAGATGATTGGGGAATGGCC
TGCTCGTGAGCTAGTACTCGCGCGAAGAGCTCGTCTGGTTCACATCGCAGGATTGGATGAGTGATCAACCCAAGTCGAGACTACTTTTGAGAGGATGCGC
AATGGTTTCGATTGCGAAAGAAAATGTCGTTTGAATGTGAACCAGCAGAGTGAATGTTCTTCCTCAAGTAGCATTTCATCAGACTCAGATGCATGTTGCT
GGAAAGTGAGCCCAAGGAAAGTATTCAGTACGAGCAACATTTTCCAGCTGTGATGGACAAAAGCACAAGAGTCTCAGCCAACGTCGTCGTGAGAAACAAG
CCCAGCAGCGCCTTTAGCAGCCAGCGGCAGCAGAGGCGAGAGCTCCACATCCGCTAACGCTTCTCCATCCGCACAGTCGCCCTCACCACCAGCAGCAGAA
CTATCAGCAGCAGTAGCTCACGCAAGCGCTCGTCCTCTCCATCGCTGCGTTCTCCATCCGCTCTCAACGCGTCAACAGTCGCTCCAGTCAGCCAAGTCAA
GCGCGCGCTCTTCTCAGCCGCGCGCTCCCCCCTCGTTAGGCGCCAGGCCACGTAGCGCACGCGGACAAACAACAGCCACAGACAGCAAACACTTAGCAAG
CAAGCAAGCAGACAAGCCAGCTATTCCAGCTCGTACTCATCCATTCTTCGCGCACCCTCAAGTCTCCGTTAACCAGTAGCGATCGCTAGGCATGGGCAAG
TTCCTGGTGCGCGTGGTGCTCTTCAAGTGCTCGGACCTGTTGGCGGCCGACCTGGACGTGGTGGGCGGCAAGAGCGACCCGTACGTGGTGTTTAGCCTAG
GCGAGTCCACCAAGAAGAGCTCGATCATCATGAACACGCTCAACCCGCAGTGGTCGCCGCCCGAGAAGTTTGAGTTCGAGATCGCGGACTGGGAGTCCGA
GTTCATCGTCGTGCACGTCTACGACTACGACCGCTTCTCGCGCGACGATTTGATCGGCNNNNNNNNNNNNNNNNNNNNNNCGGCCGTGATCCCGCTCGCG
CTCTACACGGGAGACCGCCACCTGGAGATGTACAGCTACCCACTCGTGCTGCCGGACGACATGGGCGGGCCCGGCGCGCCGCACAGCGATATCTTCTTGC
AAGTGAGCCTCACCACGAAGGACGGTAGTCCCGTCGAGACGTACGATTGATTTGGATATTGGTTAGTTGGATTGTCTATTGAGATGTTGTTGCGGTGGTA
GTGATTGCTAGGACTTGCTTGTGGGAATAGGGTGTGCTCTGTGTGTGCGATAGGAACTTAATTATAAATGGATATGAAATTACGTGGAACAAGAGCTTGT
TCGGCTTGTGTTGCACCTTGCGATACGTCTGACTGAGCGGCAACATCAACACTGGCATCGATAAGCAAGGCTCTTTGTTGACTGGCGGCACACTTGCTAT
GCACCCACGCGCGCGCTTGCACGAGTGAGTGAATGCCATGCACTATGTCACACGTGCGCACACAACAAAGAGCCCCAGGACCATCGATCGCGAAAGAAAG
CAAGCGCGACTCTGTGCTCGGGCTCTTGCGCAAGTGGCTGGCGTGTGTGCGTGTGTGTGGTGGTGGAGAACTGACCTGACGAGACTGGCTGGCTACTCAA
GCACTGGCTGGAGAGGCCCGCACCCACTCACCCCCCCACCAGTGGCCCTTGCCTGCTTCTGCTGCTTCTGATGGAGATGATTTTTCAGTCGATGCGTGTC
AAAGTACACCAACGTGCTCCGTCTGCAAGAGCAATTAGAATTGTTGCTGCTTCCACGGCACAACAAGAACAAGCGAGAAAGGAACCAGGAACAAGCAGCA
CAACTGGTTAAACCAGTGGCACCACCAACCCAACCCATCATTTTGAATTGGACGGCTCCAGGCCACTGAATCGACAATGAGGGGGCGAGCAATGCAACAT
CCA