Description :
From Genome Similarity Track
Location :
Scaffold_553:357- 1602
Sequence
1245 bases(100 bases per row)
ACAGACGAAGGCAAAAGTCGAGATGCTAAGGTCCCCGAAACAACAACATAAAACATTAAAAAGTCGCAACGCTCAGGCCGAAACAGTTTGAGATGAAGGC
TCCAGGCAATGACTAGTTGGTCGGTCCCGAGACATCAAGTCCCGACACCAAGTCAGCCAATATCGAACGATTCGGGCCGCTTATCCGGTCGGACGCTGAC
AAAACGATTGCATAACACCGACGTAAGCTCTACACGCTCTTGAAATGCGACCCTGTTACTACATCCCTCGAGATCCGGCTGATTGGACAGCTCTGCGGAC
CACTTTCTCCCCTTCCAACGATACGGACGATCACAGAGGCAATCACCGCACTATTGAACCTCCTTCGGGAAGCAGGCATGGTCGCGGAGAGGTTCGAGCC
GAACGACGTGTTTGCGTTAGGGTTGGACAGTATCACAACGACGTTAGGAAAACTACACAAGCGTGTGGGGATACATGTCGGAATAAACCTTGCGAGACAA
ACCTTGTCTTCCGCCGCAAACGTGTACGAACCAAGGAGAAACAGTCAGATCGCGCTCCAAAATATCGAGGTCTACCTTCAAACACAAGCAGTGACCTGGG
ACCCACGGTCGACGGAACTGCCATTTCGCGGAACCTAGTCTCCACGTGCCCAGGACTCAGCAGGGTACTCGTCACAAGGGTCATAAGCGACCAGCCACGC
CACCCGAATGCCACTGAGACCTACAGGAGCCTCGTTGCGCTAGGCGTCCGCGCGCGAGAAGCGCCGGTGGAACAACCCGCTCCAGAAGAGCCGACGCGTG
GACAGCCAACAGAAATGCTGACTCCAGATAGACTGAAATTTCGCCCAGCAGAAGAACGAACGAATCAACCTGAACCTTAACACCACCACGTGGCGAAGAT
TCTGGGGGGGGGAAGCACCTACCGACCCGGTAGGTAATCTGCAAGCATACTTCGACGCGGCGATGGCAAGGTTTCTCCAAGAACGCCAAGTGCGATCAAC
ACGCCCTAACCGAGGAGAGACCAGAGGCAGACAGGAATCGCGACTGGCGAGCACTAGAAGCGGTCCGAGTAAAGAGGTTCAAGCTCAAATACAACTCATA
ATGTCGGACGTCGAAATGGAATCGGTTGGATCGCGCGAATACGACCTGGACGACCTGGATCTGGTGGAATCCCAGCGAGGATGGCCAATGCCGCAATGGG
AAAGGTACTCAACATGATCCCTCGCATCAAGCCTTCTGCAACTTC