Description :
From Genome Similarity Track
Location :
Scaffold_2206:357- 1369
Transcript NameFunction/comments
Phymu_g13959hypothetical protein PHYSODRAFT_341850

Sequence
1012 bases(100 bases per row)
CGAGACGACCGCCTCGACTCGCCATCTCCCTTTCTACACCTCCTCATGTGACTGCATCACGCCGAATCGGTTACGGTTCACGTGAGTTCGCAAGAACGCA
CTCAATATTGCTCCACAATTGAGATCTGCCTCATCGACCCAAGTCGGATCTTCATAACCCACCCAGTGTACCAAGAATTCTCGATAGATCCGGCCGTATC
GGGTTCTTTTCCCACTTCGCATGTCCGAGATTCGCTCGACTTCAtactcgtcggcttcgagaTCAGGGGTCCAGCTATCCTCCGGAAGCAAGGCCTcatc
gaagtcgaagcgatCTGCCTCGTCTACTGTCAGCTCGATCTGGGGTCGGTCAGGGAAACTCCGCACCAACTTCAGTTTCGAGACATGGACGATCGGAAAT
ATCTGATATCCGGTTCCAgcgatctcgagcttgatcGTGAATTCGTTGATCTTCTCGGCGACCCGGAATGGGCCATGCCAGAGGTGGGCTAATTTGCGGG
CGTTGCCTTCTCTCACCCGATCGAGATATAACCAGACTCGAGATCCAACTTCGATCTGATGCGGCTCGACGTTCTCGTTGTGTCGGTCCGCTCGATCCGA
GATCGCGACCTGTAATCTAGCATTGACTTGCTCTCATGACTGCTGATAGTACCTCTGAATCCGATAGCGCCATCTGCGCGGATCGCAATCTTGGCGCCTG
GTAGATCCAACTGGTATAGTCGCTTCAAGGGTGGATCTCGGATCTCACCCATGTACCAGGTAATGAGGAGTGTCTCCCCGGACTCGATCATGGGCCGTAT
TAATCGCGAACGTCAACCTCTCTGCGTATTCGTCCCAATCCTTCTGATCTAAATCTTGAACGTACATTTTGAGTGCTCGAGTCACCGTTTGAACCATTCT
CTCCGCCGATCCGTTGGCTTGAGGTCGATACGCCATCGTAGCTCGCTGCCGCTGTCCCAGGATTTTGTTGAACGATCTGAAGAAGTCCGACATAAATCCT
GGTTCCCGATCA