Description :
From Genome Similarity Track
Location :
Scaffold_100:35685- 37677
Transcript NameFunction/comments
Phypl_g3109myosin-like protein

Sequence
1992 bases(100 bases per row)
CTCAACTACCTGCACGAGCCGGCCATCCTGTTCAACCTCAAGTACCGCTTCCTGCGGCAAATCCCCTACACGTACACTGGCGCCATTTGCATCGCCGTCA
ACCCAGTACGTGTCACATCCGTCCCACTCTACCGTAACCTGAGTTCTTAACTGAACACTTGTACCCGCGTATTATAGTACTCATGGCTCGACATCTACAC
CAAGGAGCTCCAGGAGCAATACCTGGAGCGCGACcgcagcgagctgccgcccCACGTGTACGCCACGAGTGCTGGCGCCTTCCAGCACATGCGGGTCTTT
GGAGAGGACCAGAGTATCCTCGTGAGTGGTGAGTCTGGAGCCGGTaagacggagacgaccaAGATTTTGATGTCCCACTTGGCGTCGGCCGGCAGCCACT
CCACCTCAGACGcgcaggccaaggaggccaGCATCATTGAGCgtgtgctggacgccaaccCGCTGATGGAGTCCTTCGGTAATGCCAAGACCTCGCGTAA
CGACAACTCCAGTCGCTTCGGTAAATTCTccgagctgcagttcgacgCGCTGGGTCAGCTGATCGGTGCCCGCTCCCGCACGTAtttgctggagaagtcg
cGTGTTTCGCTCCAAGGCCAGGGCGAGCGTAACTACCACATTTTCTACCAGTTGCTGGCTGCCCCCGAGGATGTCACCACGGAGGTGAAGGTCACGGGCA
TGCAGGCCAAGGACTTCCCGTTCATCAAGCCGCAGGAGGAAGACCTGGCCAACGGCATTGACGTCAGCGCTGGGCTGAAGGATTccgagcgcttccagca
gaCGGTGTCGTGTCTGGAGACCATGAGCGTGTCCAAGGAGGACCAGATGAGCATCTTCAAGATCGTCGCGGCGATTTTGCACCTGTCGCGCCTGCAGTTC
GAGCCGATGTCTGGGAACGATGATGCGTCGCAGCTCACGGGCACACCTGAGAACCAACACGCGAGTGAGCTGGtgtcgcagctgctcgagctcgacgaca
aCCAGTTGCACACGGCGCTTTGCACGCGTGAAATGACGGCTGTCATGGAGACCTACGAGGTGCCGCTGAATGTCTCGCAGGCCGAGGGAGCTCGAACGGC
TCTGGGCGTTGCCCTCTACTCGCACATGTTCTCATGGCTGATCCACCGTGTGAACATGTCGACGAGCGCCCCGCACGCAGATGTGGCTCACAAGATTTGC
ATCCTGGATATCTTCGGTTTTGAGATCTTCGAGAAGAACTCGTTCGAGCAGCTGTGCATCAACTACGCCAACGAGAAGTTGCAGCAGAAGTTTACACAGG
ACGTGTTCAAGTCCATCCAGCAGGAGTATGAGGACGAGGGCATCCCGTGGACGCGCATTGAGTTCGCTGATAACGTCAacgtgctgtcgctgctcgaggg
CCGTTTCGGTGTGTTGTCTCTGCTGAACGAAGAGTGCATGCGCCCCAAGGGTAGCGATGCTGCGTTTGCCAACAAGCTGAAGGCTCACTACAGCGACAAC
GACCGCTTCGAGTGTCCCCGTTTCGCCCGTGATGCCTTCGTGATCAAGCACTACGCCGGCCCCGTGCAATACGACACGGCCGGTTTCCTGATCAAGAACA
CTGATGCGCTACAGAACGACCTGATCCTTCTGATTAAGAAGTCGAAGGCGCCGTTCCTTAAGAAATTGTTCCCGGATGAACACGTGGGTGATGCGATGAC
GGGTATTCCCGGCACGAatgcggcggctgcagctaACACTTCGCGTGGACGTCCCGGTCTCAAGCGCAAGAACTCGATTGTTGCCGACACGGTGGGCACA
CAGTTCAAGAGCCAGCTAAATGGCCTCATGGAGGATATTCGCCGCACGAACGTGCACTACATTCGTTGCATCAAGCCtaacggcaagaagagccCGCTGA
TTTTCAACAAGCTGCGGGTGacggagcagctccagtgtGCCGGTGTGGTGGAGGCTGTGCGCATCAGTCGTATGGCGTACCCCAACcgtgtg