Description :
From Genome Similarity Track
Location :
Scaffold_94:35666- 38864
Transcript NameFunction/comments
Phymu_g4113hypothetical protein

Sequence
3198 bases(100 bases per row)
GCGCCGAGATCACGCTATCGAACGACCAGCTGTGCCGCAAGAGCTCTATCCTGCGCGGCTTTGTTGCAGACCCAGCCATTGTGACGAAGCGTATTTCCTT
TGCCCAGTTGCACTTCCTACGACTACTCGCGAAGGGAGGCAGTGGTGAGGTTTGGCTCGGCCAGTACGAGGCACGCTACGTGGCAATGAAGTGTCTGTTG
CCTACAAAGCGTGAAGACCCCGAGGCTTTAGAGCAGTTCGCGGAGGAAATTCGAATGGCGTCATTATTAGCACACCCGCGCATCGTCGCCTTCTGTGGCG
TGGCCTGGCAGTCGTTGCTCCACCTGTGTGCCGTCACAGAGTATATGGCTCGTGGGGATCTCGAGAGTTTATTGGCGAATCCAGTGGCACAAAAGGAACT
GAGCTGGAGCAGAGAGAAGCTCATGTTGAGCAGTGACATCGTTGAGGCTTTAGTGTACCTACACTCGTTGGTGCCGGTGGTGATTCATCGGGACTTGAAG
TCCAAgaatgtgctgctggatcgaCGCTTACGCGCCAAACTGAGTGACTTCGGGCTGAGCCGTGAACGATCTGTGGAGGATACGATGACGAACGGCATCG
GTACTATCCTGTGGAGTGCACCGGAAATGTTGGAGGGAAAGCGTTACGATGAGAAGAGCGATCTCTTTTCCTTTGGAGTCGTGTTATCAGAGATCGACAC
GTGCGCGCTGCCATACGGATTTAGCCGTCACGCCAAGATGCGCAGCATGCAGATCGTCCACCTCGTGTCCGAGGGGAAATTGTTACCCAACTTCCGTGAC
GACTGTCCGCCGGCAATTCGCGATCTTGCGCAGCGGTGTTTGAGCTTGGACCCAGCAGCCCGTCCGACAGCCATGGAGGTTGCCTTTGAGCTGCGCTCTA
CCATTGCGCCGCAGCTTCTCAAGCAGCCAATACCGACGATAGccgatgacgacgacagcatTATCTCATCTGCATCAGCTCTGAGCGCGGGACACGTAGA
AGACGATAACAGTGGCGTGGTACCATCACCAGTGCCGGTTGACACGGAAGTTATCGACGCAAACACAAAGCACACCCAGACAGAATCATGATATTTCAAG
CGAGAAGCAAGTCGCCAATGTTAGGAGCGAGTCTTGGCAGCTCGCATTTTACAGACCAAAGGTAGCCCATTAATTTATCAGAATTGTACAACCAGAAACT
CCAGCAAGTGTGTGCGCAAATGTACAGTAGATGAAACGGACGCTGGCACTATTAGCCAGGAGAATTTCAGAACTCGATGGAGACAAGCAGCGAAAATGAG
CCGTCGACACCTGAATCCGTTCGTAAAGCGCGTTTGGTCCGTCGAGTTCCGATTCTCGCGCATGTCGTGAAGCAAGGCCTGTGTTCCGAAGGGGAATTGT
TGCGAGCGTTAGAGCTGGTGACGTACGTTGATGGTGAATACATTTACTGCCAAGGACAACCTGAACGTGACGTTCATTTCATCGAAGAAGGCAAAGTTTT
GATCACTCAGCGTCGACGATCTCGCGCTACGAGTACCGTTCGACCAGTAGGTTTTATTCCGATGGACAGCTCGGGTGGCGTTGTTTTCGCTCGACGCagc
actcgtcgtcgttcacAAATTGAATCTGAAATGGAAATTCAACTACACAAACACGAGGAGCTCGAGTATTTCGGCGAGGAATCGTTGCTTCAAGGGCTGG
TTTCGAGGATTCTAAATGCTGTAGCAAGTGGCGCTGTGACGTGTTTCGTGCTTCCGGAATCTGCCTTTGCCAGGTTGCTAGCACCCGTGCATGAATTGAT
GCTACATCGACATTTACTACGGATGCACGGGGTGTTAGCGAAGCAACGTGTAATTCAGCACTTCTCTGCGCGTCAAAGACAATATTTATTAGACCGCTGT
ACTCTTGAACACTACGAGGATGGAGATCGGATCATACTGCAAGGTGACAAGGACGACGATCGCTATTTCATTGTGGccgaaggtgaagctgacGTGGTTT
TGGATGAGCCTTTACGAGATATGAGACGACCAACGAGTGCTACAATACCAATCGGTCTTCAggatgatgaggaagaagaaatggGGGTACGGACATCCAC
GGTATGTCGAAAAACTCTTTATCAAGGATTTGGCGAGATGGGGATTTTATGCCGCCCAAGAACAGCCCACGTGGTGGCTGCGGGAAGCGTGATCTGCATG
GCAATTTCACGGAAAGCTTATATCGGAGCTTCGCAGCTGATTGGCGTCGGTGGCGTGGATactgacgctgaagctctgtTGGCAATGTCATTGATGGAAG
AATGGGCTCTTGTCGTGAAAACGCGAAATTTGCATTTGGCCAATCCTCTGGTATCTCGGCATCTTGAAACTTTTGTGAAAAAGTTTAAAGCTGCCTACAT
GCAAAAGTTCGAAGGCAAAACGCTGTACCTGGATTTACTACGAAGGATGAACGCTGATTCGACACTGGCCGATGAATTCCCCTTTCTGTCTGACCGTGTG
GCTTGGGAGCAGCCAACGTCTTCACTGAGCATCACTCGAGCTGAAACTCGGCGTGTACTTTCATTGGCCCCAGCTGAACGTTCTCCTTTTGAGATCAGCT
TTATGGCCCGCTTGCTCGAGCCTACAGCGTTCATTGACAAGTTCGATCGTCCTAGTCACGTGGATAAACTCACTCTTGCGCGAGGAATTGGACGCTTTGC
TAACTTTCTCACGGTTCAAAAGGACAAATTTCTGTTTCGACAGGGGAAAATCGAAAGTCGCGCGTTCCTCATCTTGCGAGGCAATATCAACATCGTAAAC
GAAGATGTTAACACCCTTCAGGCAGGTCTCACCCTCAAACAGTACGACGTGCTTGCTACATTATCTGCTGGAGACTCTTTCGGAGAATTATCACTTGTCA
CTCGCCTACACCGATCAGCTACAGCTCTGGCTGCGTGTGAAGCCGATCTGTTAGTCCTGGAACGTGCACACTTGCAAGCTTTAATGGCACAAATCCCTGG
AGTTTCTGTCCAGCACGCGATGGTCGGACGTGCAGAATTTCTTGCGACTTTAAGCTTTCTCCGCGATGGCGATTTCGCTCAGTGCATCCGAGTGGCACAC
GACCTCCAGGAGCAAATCTACGAGCCGCGTCATATCTTTCTTCAAGAACCGGTGCATTTGCGCTCGCTTTACATTGTGAGGAGTGGAGAAGTGGTCGT