Description :
From Genome Similarity Track
Location :
Scaffold_212:35660- 38351
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.860S ribosomal protein L23a
Pytir_DAOMBR486maker-pir_contig_212-snap-gene-0.32Striatin-3 family protein

Sequence
2691 bases(100 bases per row)
TTGCTAGCCGGTGCGAAACAAGTGGAGGTGCATTTGATTCCCTCGATGTACACAAGCATGGCTGCAAGTTGAAGTGAGCAGTGAACCCAGAAGTTAAATG
AGTGACTTGAAACTGAAATATCTACAATAGGGACTGTGTGCACTGCATTTTATTGAATGTGGTCTTCAGGTGGGAAAGAGAAGCTGGTCAGTTCGAACAC
ACACATAGAAGAAGAAAGAGATCAATATGGACGCGAGTCTCTAGCGTACAAATTGAGACTTGTATTCAAGTAGATGCCGAGCGAGGCTAAAACGCACAGA
GCAGGTGCACAAATACGAGCTCGTTGCGCGCGCTGCTCGGATCATCAGAGGGCAAATTCTTATTTTTCATGGACATTTCAAGATCGCACCGGCATGCTTC
TCTCAAGTACGCCATTCACATACAGCATAGCTCACTCTATTTCCGATACAAGATCAATCATTCGACCCAAAACAAGTCCGTTTCCAGGCTTGCAGCCCAA
AACACAAGTTTGCAAAAACCCAAACTGCTTGAGCAGACAAACGTTGTCGGTGATTGGCTGCACGAGGCACATTTGCGCATTCTGATTGGCCTGGATTGTA
ACTATCGGAAGTGCTATTTCCGAATGGCCTTATATATTTGGCACTGTCCTGGTGAAACTGTAATTCACTACAAACAGCAAGTGAGCAATCCCGTTGCTCT
CCAATCACCCAAAATAAAATACCGGTACACCATCGTACCGGTATTTCATTTTGGGTGATTGCAAAGTCATTCTAGCCAATCGTTCGCTAACTGGGGAAAG
CCAGCGATTGCGTTGAGGCTTTTGGGGCTGCGCGAGAGCACCAGCCGCCGCCGCCCAATGCTCGCAGCGTAAAAGCATTTTTCATCTAAAGCAGAGAAGA
AAAGCAAGATGGCAAAGACTACGTCCACCCCAAAGACTGCTGCTGGCAAGAAGGCCGCCGTCGTGTCCAAGAAGCTCATCAAGGGCTCGCACGGCAAGGC
CATCAAGATCCGCACCAAGGTGCACTTCTACAAGCCAAAGACCTTGAAGCTTGCCCGTGCTCCAAAGTACGCCCGCAAGGCCGTGCCAACCCGCACCAAG
CTCGACAAGTACCGCATCATCAAGTCGCCACTGACCACCGAGTCGGCGATGAAGAAGATTGAAGACAACAACACGCTTGTCTTCCTTGTTGACATCCTCG
CCAACAAGCGCCAGATCAAGGACGCCGTCAAGCAGCTCTACGACATCAAGGCCGCCAAGGTCAACACCCTCATCAGGTACAACCCATCGCGTCGATATGC
TGCCGACCGAGGGAACCAGTCGCACTCGCTCGCCTTCTATCCCGGTTGGGAGCTTATGGAGCAGCGATCGCTGGAGCTCTTTCCTTGGTCACCGTATTCG
CACAAGCGCTCGCTTTTCTTTTCTTTGCGAATGGAGGAGACTTGCTGTGGCTGGCATTGAGCTGTCTTTTTGTTCGTTCAGAACGATAGGAGACGGACTT
GATGCTGACCATGCGTGTCCATATATGCTGCTATTGTCGTGTGGAAGCATCCTTACTCACCGTTGTGCTTGTCTTTGTTTGCTTGCTTGTTTATCGTTTC
TAGACCTGATGGCCAGAAGAAGGCGTACGTGCGCTTGACCCAGGACTACGACGCTCTTGACGTGGCCAACCGCATCGGAGTGATCTAAGTGCTTTGCCTT
GTTCCCATTGCTTTTGAAGTGATAAAGCTCTTTGCCATCCTAATATAACAAGCGACTGCTTTGCTTTTGCCGCAAGGCGATCGCATTCTTTCGTGGAGAA
AAACAAATCCCCCTGTTTTTTGGTTGTCATTCTGTCTATCCTGCGCTACTATCTGCGTGAGAGTGGTGTCAGCAGCAGCAGGATCGTCTGGCATTGTTAT
GGTCTTCACATCTAAATAGAACTGACATGCGCGTGCGTGTGTGTCCAGTTCCTCCTCACCTCCAATTATGATCATCGTCGTTTCACTTCTCTTACGCCTT
CTCTCCTGCTAGCTACATCGTTGTTGGCTCATGTTGCTACTACTCGCATTCGTTTCAACAGATTGACTGCCACGCCCAATCAACTCACTGGAATATCTTA
ATCGTGCAATCCGCGCCGCCTGTCGCGACGAAGTTCCGCGATTGGTGGTATGCTACAGCGTGGACAGCTTCGCCCAGCTTTGGTCGATGAGCCTGGGAGC
ATGGACAAGAAAAACGCATATGACATGTGAGTACAAAACGATGCGACCGAGTAGATCAGCGCACATATCACTGTCATTAATGAGCTCGTACCGATTGTTC
AAAGACGCAATGGCGCTCCGCCACGGACCAAATGCGAAGCGAGCCGTCGTGACCTACAAACAAGCAAAGCGATCAGATCATGCACAAGTGAGGTGTGAGT
AACTGTGTTCGTGACCCGGCAACGAAATGACAGTGGGTAGCAAGCAATACGTAGCCTACCTCCAGTGGCGAGGTAGAGTCCAGAGGCGTCTATGGAAATG
GACGATACTGCGTCTTGATGAGCAGTCATGACACCAATACACTCGCCTACCGTCACAACCATACAAAGCAACCAAAGAGATGAGAAGGACAGACTTCCAT
GGTGACAATAGACCCTATCATTTGTCACTGGACGTACCTGCGCGCATGTCGTACATGCGGACTTTTCGATCCTGGTGAGCGGCAAACACCA