Description :
From Genome Similarity Track
Location :
Scaffold_226:3566- 4573
Transcript NameFunction/comments
Sapdi_VS20SDRG_17246hypothetical protein

Sequence
1007 bases(100 bases per row)
TACCGACATGGTGTACGAAAGCTCGCACCTCGGCACGTTTGGCTCGATGCACTTGCTCTGCAAGCGCAACGTGGCGCGCCTCGTGCGTGACTCGGTTGCG
TTTCAGGCGCGCGTTGGCCAGAGCATCATCGTCTCGGTCGTCGTTGGCTTGATCTTTCTGCAGATTGAGTTGAACCAGGCCGGCGTCCAGTCGTTCTCGG
GCGCCATCTTCTTCATCGTCGTCGACCAGTTTTTCAGCGCGACGACGCCCGAGTTTGCGTCCGTGCCGCTCGAGCTGCCGCTCATGAAGCGCGAGTACAA
CGGAGGTCTCTACCGGTCGTACGTCTGGTACATTGCCAAGAACGTCTCGGAGCTCTTGCTGCAGTTCTTCTTCCCGCTCATCTATTTGATCCCGGCGTAC
TTTATGATCGGTTTTGGCGCTTCGAACGCGACGCTCTTTTTCACGTTCTACCTCTTCATGGCGCTCCTCTCGAGCTCGGCGACCGGCCTCGGCTACATGG
TGTCGTGCATTGCCAAGACGCCCGAGGTCGCGCCCATCCTTGGCATCCTCCTCATCCTCCCGCTCCTCATTTTTGGCGGTCTTCTCATCAACACCAACAA
CGTACCCGTCTACCTGAAGTGGCTCGAGTTCATCTCGCCGATGAAGTACGCCTTCCGCGGCATGAGTCGCGCTTTCTGGAACTCGATCGACACGATTCCG
TGCGACAGCGCGCCGTGTGCCGCGACGACGGGCGCTCAAGTTCTCGCGAACCTCGGTCACGACAAGCAGAGCATGGGCTACGACGTTATCTTTTTGATCT
GGATCAACCTCTTCTTCCGCTTGATTGGCATTGTGGCCCTCTGGATCTCGCTCCGCAAGAAGAAATAGGCGTTAATTAAGCAAACGATTATACCAGGTAA
GTCATACTAAAAAGGTACCATAACAGAAGTGAGACAATTCCGGACATCAACAATAGTTTCTACTGGTATACGATACATACTCATAACTTCATGAGTAGTC
GACTGTC