Description :
From Genome Similarity Track
Location :
Scaffold_13:356582- 362109
Transcript NameFunction/comments
Physo_531594PREDICTED: switch-associated protein 70-like

Sequence
5527 bases(100 bases per row)
CGTCGTCCGCAGTGGCTGCAGTGCACTCCAAGTACACGCCGCTGCTCGTCTCGACGCGAAAACCGGTACCTTTCAGTCCGCTGCCGCCACTCCGTCCGAT
AGTCGTGAACACTGGACGCCACTTCTCCACCCCAACGAGCTCGTGCTCCTCCACTGCGGTGTTCAAGTTGTCGTCCTCATCTTTGGCCTCGTCATCGTCG
CGATCCTCCGCGTAAATCGACAGTTTGCTGCCTTCCAGCACCACGAAGCGGTTGCGCCAAATGGAGCCCAAGTTGTGGTGTCGGACGCGTAGATGCCCCT
CAACCTTTGTCGAACTCGCGTCTGCACCAACGATGGCGTTGGCTTCCGCTGCTGCGGTGCTTGCAGCGATGCTGGCCAGATGCGCGGCCACTTCTTGGGT
GAACTGCCGCTCCGAGATGCTCAGCGATCGCTCGGCCACTACGAAGTTGAGCTCGTGGTGAATGGCGTGGATCCACTGGTGCTTGGCCTCGATAGTCAGC
GCCGTGAAGCAGATGCCGTGACGGGAGTTCTTGACTTCCATCTTGAAGCCTAAGTTCTCGTTCTCCTTGCCAATCGTCAGCCACGACGCGTTTGGAGCTT
CCCACGGAGTGCACGCTACGATCTCAACATCAAGCGACGGAGGTTCGTCTTCAGCTGGCGGCGACAGGAGATTCCTCGAGGATTTAGCGGCAGCGGCACC
CGCGGCAGCTTCGCGTGAGGAATAACACCTCAAGCGACAACCGATGAGCACGGCGTACACGGACATCATGGGCTTCATCTTGGAGCTACCAGGCAGTCGG
ATCGGAGAGGTCGAGGTCTGCCACGGGGTCAAAAGTCCCTCCATAGCTGCTGCTCGGAAGACGAAGGATGCTGCCGCCTCGCTCTGCGGCGGTAAAGTCT
CTTTGGCTTCTTCTGAAGGGCTGGAGACGTCGATGTCGATCGTCAAGGGTTTGTCCTCGAATCCGCTATCGTCGGAGCTGTCGTCGTCGTCGCTGTCACT
GCTGTCTTCACTCTCGCCAGCTTCACCTCCGGTTGCAGCAGATTCATCGACCCCCGCCTCTATATTCTTCTCCTCGACAACTTCTTGCGCTCGTTCTTCT
TCTTCTCGTTCCAGCTTGAGTATGATCTTCTCGTCGGCGAGCAGCGCTTCCCCTCTGGTAAAGTCGATGCGGTTGGCGAAGGCCTCCATCCAGAGATCGC
GTTGCGACGGCAGCGTCGGGAAGAACTCGAGCATCGCCGTGTGTTCGTCGTGGTCGTTGTTCAAGTCGTCTGCGGACGCGTTGCCGTCGCCTCTCAAAGG
ATGGAGCAGCACAGCGAACGCCAAGGAGGAAGGGACCACCTCCTTCGCCCCCGGGAAGAAGTGACGGAGCGTTGACTTCGTCTTGGGACTGTGAGTCGAC
ACAGCAATGGACGCCACGCCCTCGGACAGCAGCTCCACGGCTTGAGCTTCACACGCTGGCGCGTCTTGACGGTAGTACGCGCTCTCGTCCTCGTAGACGG
CGATATGCGCGCGCATGTCCAGCACCACGAAGCCTTCGTGGGGAATCGGCACTTGAGAGGCGTGCCGAGCTTCTCCAGAGGAGAGCGGGGACTGAGCGAG
TCGGAAGGCCAGGTATCCTGTCATCGGAGGCTCTTCTACCTCCTCCTTGTGCTCCACAAGTACAGGTTGTGGAGGGACAACGACGCCTCCGTCCTCGTTG
AAGCCTCGTTCTCGCTTGTCGACCAAGCTCCTGCGACCTGGAGACATCGGCGCGGTGGTCTCCAATAGCTGCTCCTCCAGCATCTCAAGCGCTGCTGCCT
GTTCGGCTCCGAGACGAAGCTGGCGGATCCACTTGGCTCGCTCAGCGTCGGTGGCTGCGCTGCAGCTCAAGACGAATTGCTCCTGCGTCACGATCTGGAA
CGGGAAGCGCGGCGCGCGGTTGCTCGCGGTCACAGGCCAACAGCGAGCGCTTGGAGCCCACGCCCGAGTGCTGACGACCCGGAATCGCGCCTGCTCAGCG
CCGACTTTCTCGGACGACGTCGACTTGGTGATGACGAACTCGTTGCCGTTCTCCAGCGCCACGGCGCGCTCCTCGATGGGCATCGCCACCTCTCGTCGCT
TCCAGTGCTCTTCCTGGGCGCAGTTAAAGTCCAGTCTCAGCAGTAGGAAGCCTCTCGCGTCCACTACGACGCTGCTGGCTCGAGATCGTGGGTCCATACT
GGTGTCGTCGGCCAGCAAACTCTGAGCCAGCACCGTGTCTAGTGCTGCGCGCAACACCTGCACCCACAGGCGCTTCTCCATGGTATCACGCGCCTCGAAT
CGCAGCCACTCGTGGTCGCTCGTCTCCACAGCGAAGCGATTCGCGGCAGATTGGCGTCCGTCATCGTCTTTCACGGCCAGTACAGTCATGCTTTCACCCA
GGCCAGCGCCTCCGCTCTTGAATCCCTCGCGCGTGGCGAAGAGATTGATCGTTAATCCGTCCACTGCAACGTACACCGTCTGCGCGCGCTTCCAGAGCGA
ACTGGTGTTGTCTCCCATTGTCTTCTTCAGGTACCCGTCCAGCTTCAGCGTCGCGAGAGCTGTGGCTTGTTCCGGTAGCGGAGGCAACAGTGACAGCAGA
CTCTCATCCGCTGCTAAACCTGTCCCGTACGCCTCGTCGATAGCCTGCAGCAGAGCTAACTCGCGCTGCGCGTAGCAACTCAGCAGCAGATCCAAGTCCG
GCAGCTTCGCGGGGTTTCGCACGCGGTAGAAGTCTGCCAGCTTCTCTCGGAATTGCTCGCGTAGCTGCCGTTCATGCTCGTTGCCGTCCTCATCCTCAAG
CTCAGCTCGGCGCAGCTCATTGCGAGCGAGAGCGATGCCCCGACGGAACGCGTCGACCCACTGCTGCTTCTCCTTGGCCGATGACGCAGCGCAGAAGAAG
GTTTTGCCGTCCGTCGTCTCCAGCTCCATGCCGTGCTCGTACGTATGAGCCGCAGTTTTGCCGTGCCAATCGCCCACGACCTCAACGCGGAAGTTGCCCA
AGGGGTTCGTCGTGGCGCCACCGCCAGGATTCTTGCTGTCGTCGTGCGTGACAAAGTACGAGAGTTCGTTGCCCACCAACACGCAGTATCGCTTCCGCAT
GGACGGGATCTTGTGGCCGCGCTTCATGAGGTACCCTTCCATCAAGATCACTGGCGTTTCAATCGCTGGCTTGGCTGGAGACGCGCTCTGGTGCTCTTCG
GCGTATTTCGCAGCGAGATCGGCGCACAACGACGTACACACGGGGTCTGTGGCGAGGTTGCTCTTGTAGACCGTGTCGATCTGCTCAAGCAAGGCGCCTT
CGCGTCCCTGAAACGAGTGGAGCAGTGAATCCACGTCGGACGCTTTGTTCGGGTTGTGCTTCTCGTAGAAGACGACGATCTTGGCTCGAAGCTGCTGGAA
GGAGCTGCCTGAGTCCTCCTCCTTCTTCTCATCAGACCCCACATCAACCACAGGTTTAGACTGATTCGCTACGGCAGCGCGCAACGCGTGGATCCAGTCG
TGAACGATCTCAGCAGCGTCCGAGCGTAGCATGATGACTCCGTTGGTCTGAGTTTCAAGGCGGAAGGCCATCGTCTCGGCCAGTTTGGCAGTGACCGGAT
GGAGACCCACGACCTCGTCGGACAGCAGAGCTGAGCGGCCGCTGTGAGCCACGACGCTACTGTCGAAGCACTGCCACCTGGTGCCTTCCAGCACGCAGAA
ACACTTGCGAAATGAAGCGCCGAGTCGCGGGTGCTTGACAGCCAAGTAGCCTTCACGATGGATCGAGACACTTTGAGCACTCGGACGCGCGTTTGGAGGC
GACGGCTGAGGAAGGAACGCAGCGAAGCTACCGTCGGAGCTGACGCTCGTACCGTACGTTGCATCCAGCGACGCCAACAGCTGACGCTCACGTCCTGCGA
AGCTTGTGAGCAACGTGTCCACATCGCCAACTCGTTTGGGGTTGTGTCGCTGGTAGAATTCTACCAACTTCTCCCGAAGAGTAGTGGCTTGCGTGGATAT
GATCAGCGGAGGCTCGGTCTCCTTGGGCACAACGACTGGTGAAGGTTCTACCTTGGGACTCGGCTCTGCTGATGCTGCAGTATTGACTGGTGCTGCTGTA
GTGAGGCCACTTCGAAGCTTCAACATCCACTTCTGCTTGGCTTCGGCTGTAGTGGCCTGCAGTACCAACAGCTCGGTTGACGATGAACTGCCCTGCTGCT
CCGTTCCGTATCCACCAGACAGGAAGAACTGGAGCTGCTGATCCGCCATAGTCGAGCGATTCATCGTCGGCGACGGCGTCGGGTAGTCGTGAACTCCCGT
CACCAAGAACACCGCCAACGGTGGCCCAGCCCCACTCTGCTCCTCCGAGTCATAACGTTCCAGTCGACTTCCAGACAAAACGCAGAAGCTTGGACTAGAG
TCTTTATTCCACGTGAGCCAGTCCGTGAGATCCCCGGACGTTCGGGTTGCAGGTGACGCAGGAGCACTGTGAGGTGAAGGAGCTGCTGGATGTGGCGATG
GGGCCTGTACCAGCGCTGACAGGATAAGCTGAACCCTGCTGTCCCTGCCCATGGACGTGCCATACAGTCGATCCAAGTGCTCGACCAGCGCCTGCTCCCG
ACCTTGATACCGCGAGAGGAGCATGGGGACGTCACCGAGTTTCCCTGGATGATACTCAGCATAGTATCGCTGCAAAATTGAGAGGAATTCACGTCGAGCC
GAGCCGTACGACGGCCGACGCTGCGGCTGACGGGTCTTTTCCTCGTCTTCGGACTCACTGGGCTGGTCGAACAACCTGGAGCCGCGCTTCGAGTCGTGCT
GGTACTTGAGCAGCGCCTGTTGCACGCCACTCACCCAGCGGTTCTTCTCTTGGAGACTGGGCGCGCTGCAATATATGGTCTGGTGCTCGGTCGTCTGGAG
CAGGAAGCCGTGGTCGTAGTGCATGAGCGTGGCGTGGCCGTCCCAACTCGAGACTCCGCAGGCGTGGAAGGTGGCGCTGCGTATTGCAGGCCGCTTCAGT
GCCGACTCGGACGCAGCAGCAGTCGAAGCCTCTTGGTGTGTGGTGAAGACGTACAGTGTGAGCGCTCGTAATACGCAGTACTTCTTCTTCATGGTCTCTT
CGAGCGAGCTCTTGCCGACGAGATAGCCTTCCACCACCACTTCGGAGGTCAAGGCTTCAGCTTCAGTAGCAGCAGCGGCGTCTGGAGGCTGCGGACTGGA
GACGGAATCTGTATCTGCCTTTGCCTCCTCCTTCTTGGGCTCTTCAGTCTGTCGCTTGGGCGAGAGCGGCGTGGACGCGAGCAAGTCGAACGAGTCTCGA
CGTGACTTGGCAGCGCGCGCGCGATGCGGAGACAGCGGAGGCATGGTGAGCCCCACGTGCAGCGCCGAGATCCAGTCCTCTTGGCTCTTCTTGAGCGGCG
CGCTACACCGCAGCGTCTTGCCCTCGACTGTGAGCACCGCGAACGCGTTCGGATACTGCTCGTTGACGTTGCCCTTGGCGCTGCCTCCGAACGGTACCAC
GAGTCTGCGCAGCGGCGACGTGGGCTT