Description :
From Genome Similarity Track
Location :
Scaffold_70:356541- 360767
Sequence
4226 bases(100 bases per row)
AGTATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTAACGGTCCGCGCCCT
GTCCCAGACGGTTAACGTGTCTTCCAAAGGTCGCTGAGTATTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGC
GAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATAGGGCCGCATCCGATATTTGTTGAAAACTCGGAGGTGACGCCGTCGAG
TCCCTTGCACCTTGGCGTCTCCGTACATCACCCGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCA
ACCACGGAGAAATCACTACACCACAACTGCCCCTGTCGCAATGGAAGCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTC
GCCACCGTATGTCCAAGCGTCTGAATCGAGTCGTGTCCGACGCGTTTCAGCGTCTCAATCCTCGTAGACGTCGCGAGCGTGAGCAGCTGGAGGTACGTAA
GCCCATCCTTCTCTTGAATCATCGGTACCTTGCTCATCACCTCGCATTACTCGACTTGTTTCTCAGGAGGGCAAGACCGAGGGCTCGAACGCCCCTCAGT
CTGCTGCACTTCCTCCGACAGCAGCGTCATCAACCGGTCCTCCGGCGCCCGCTGCTCCAGACTCTTCACTTCCTGCGGTAGCTCCTGCAGCACTCCCCGT
CGTCGCTGAATCCGCGGAGATGGCTCCTGATGCTCCTCCTGCCCCAGCTGGTGGTCCACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAA
AGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAGATCAGCGTTGTGCCTCCTCTCC
ACGGCGATATACACACTCAGCGTCGTCTCGAGACAGCTATTGGTTTCGATGAGGTCCTCGCTGCGATACAACCTGTTCCTGACGCGCTGTCGGCATTACC
CCAACGCGTTGCCGACTTAGAGCGTCAGTTGCGGTTTGCTCAGTCCGAGGCTGCTGCCGCCGTGCGTTCGGTGGCACCCCACATCATGGCTCGTGAGAAC
GCGGAGACGTTCCTCAAGGCTGCAAACGCTGAGATTGAAGCCTTACACCACCACGTCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTCG
CCACTGTTCAAGCCACTATGGAACGACACGCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGACGTTTTTATCAGCACGTTGCAGAAGAA
GCTGGCTCGCGAACGCGAAGTGTACAAGTCTTCTATTGGCGCGAATACTGAGCAGACCCGGAAGCTCCACCTCCTTCTGGTAAAGCTTGCCCAGGGCAAG
TATGTCGATAACGACACGCTTAAGGTCCTCGAGAACCAGCAAGACCGTAACACTCGCCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCTGG
CAGGGATGGATCCCGAGGTACTTCGTCTGGCTGTCGAAGGTACGCCCTTAATGTTGCTCCTTCCACCGTGTGTTCAGCAACTAACGTTCGTTCACAATCC
TTCGTGATAGGTCTGACTGCGGGTGAGCTGGACCTGGATGCGCTGGACTTGGATCAGGAGACGTTAGTCGCTCTGCGGCGTATTCAGTCTGCCACTGCTT
CTTCGGACAATCCTCAAGCCTTTCCGGCAGCTTTGGCCAAAGCAGCTCACCAAGTGGCCCATGGGAAATCCCATAAGCGTCTTAGACCAGGTGGCGAGGA
TTCAGACGACGATCCGGACGACTCTGACGAAGACAAGGCTCCAATCCCAACGGACAAGGCCAGTGCTTCGATGGCAGCTGCCGGTCTCGGTGATGCGCCA
CCTGCCGATACTTCAACTCCCAAGTCGGCTCGTAGATCGCTGTTCGGTCCGAAGGCGTGGAAGAAGGCGGCCCAGAAGAAGCGCAAGAAACCCCGTCCTC
ATTCTCCTGCTAAGTCACCACGACGTCATATAAAGACTCGGTCCAAGTCTGTACCGTCTTCTCCAAATTCATGGTCGCCACCTCCTACACCAGCGTCTTT
CTCGACTCCCGCAGTGGTCGACCTCAGCGGCGACCAGAGTGACGTGGACATGGGGACTGCTGATCCAGGCAGCGTCCCTTCGGTTCAAGAAACTGCTACA
GAGCCTTCGGGTAAGGACGTGAACCCTGAGGATCACGACGATGTTCCTGTCTCTCCTGACGCGCCTTCGCTCCCGCCTCAGGGTCCACACGATGTGGCCA
AGTCACCAGCTTCAGCGATTTCACCTTCTCCAGCCGACATACGTGCTGCTGAAGAGGCTCTGCGCGAGGCCGAGGAAATGCGGCTCATGTTTGGCTCGAG
TGACGAAGATGAAGAGTCAAACCAGACTGTCCCACAAGGCAAGTCTGCTTCGGCGTCTGCCGCGACATCCAAGGCAGTTGAAGTCTCGGGAGTGGTTTCT
ACAGCAGGGTCTGCCCCTGTTGAGGCTGCTCCACTAGCTTCCGCGTCTTCGAAGTCGGCTCCGACTGTTCCCACGACTGATGTACCAAGCGTGTCTTCGC
CTGGCCTTTCGATGGAGATTGATGACGATGGGAATGCTGATGACGACTATGGAGATGACGTGGATGACAATGAATCTTCGGTGGATGACTCTCCTGATGT
TCCCAGTGGTAGCGGTGATGTTCCGCCCCCCACTGATCATTCAAGCATACTCGATGACGAAGATGTTGAAGATTCAAACAGGAACTGGAGTAATCTTGGC
CCAGCTCGTCCTCCGACTCCACCTCGGCCAAATCCTTCGCCGATGATGACTTCCCCAATCATCGTTGCCGGCCCGCCTCCTTCGCCACCAGCAAGTCCTC
CGGCACCAGCATCTTCTCTTCCTGTTCCAGTGTCTCCTCGTCCGTCTATTTGGACTCTCGATGCTGGACCTGGACGCATGATTACGGCAACCTATACTTC
GGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCGTTGCCTCACCGAGTGTTATCTGGTACTCGCTCTTCGGTGCCGGCTTCGTCCACCCTGCCACCG
TGGGTTCTTCCGTATGTGGACATGGAGTTTACCGATGCAGGCGCCAAGAAGTGTTTCGAGCGACTCCTGAGCTTAACGCTTCCTGAACCAGCTGGTGAGG
TGACCGTGCGTACAACGTTGGAGGGTCTCCAAGCGTTCTTTGATTATTCGCATCCTGATCACCCGTACCAGCAACTTCGGCAGCTTTATCCTCTTCAAGC
TTGTCTCTTTGACACTGTCAACTTCAAACCAAGCGTCCCCATCTCCAAGCGTGCCCCGATTGAGACCCGTCTCAAAATGATCTGGGCGAACCTTCGGGGT
GACGGCGGTAAGCAAGGTGACCTCGGGCTCGCGTTGTGGGAGCGTCTCCACTGGCTTCCGTTAGCTGGTATTGAACGAGGTCTCGCTGAAGAAGCTAAAA
AGGTTGGCCACGACAAGGAACGCTTGAAGAAACTGAGAGCTATGTTAAAGAAGCTCTTCAGTGAGCGCGACCGTCGTGCCGATCGTCTTCGTAACAAGTA
CCGTGAGCAGTACATGGCGTGGAGTCGTGACTCGGTTTCATCTAGTGCTTCCGGAGTGTCATTCATTCGTCGCGAGTTGCTTTTGGAGCCGTCTAAGCCG
TGGTACCCCATTAAAAACTTGCCATTCGCACCTCAGACATCTGACTGGCTTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCATGGCGTACTAATTGGA
TGGATGCGCCGCATCAGCACCCGTACAACACCACGTACTTCCCGTGCCAGCGTAATCCGGAGTTCTTCAATCCTCGTGGTACGCGTTTCGTGGATGTGTA
CCGAAGCGTGATCGTTGACCCGTCTCTCGATTCAACCGAGCTTATTCCGACCTGGCGTTCGTTGTTTGACTCGCCACCGGGTACTCCACGTCCTGCTCTG
GCCGCTGCTCCTGTTGAAGCTGGTACCGAGGATTCGCAGGGTCCGGCTTCAGCTCCAGCTGCCGAGGCTCAGGTTCTTGATGAAGAGGAGAAGGAGAGTG
GTGACTCGGCTTCGTTGACACTCTTG