Description :
From Genome Similarity Track
Location :
contig_39:356437- 357475
Transcript NameFunction/comments
g8591.t1hypothetical protein
g8592.t1XP_008895126.1 hypothetical protein PPTG_04625 [Phytophthora parasitica INRA-310

Sequence
1038 bases(100 bases per row)
CACCTTCAGGAGCACAGCATGAGCAGTGGACAGACAGTTCGGGCGGCGGCTGCGTCGTGGACAGCAAGTGGAAGGTCTGTCGGATGTGCGAGCGCAAGTT
CTCGCCTATGAGCCTCAGTCGGCAGTACGCGGACTGCTGCTCGCTCGACTGCAAGTCGGCCCTCATGTTCGGCCGCCACGTCGTGTAATCAGTCTCTCGT
AGGCATCGGAACCTACGACTGTATTGACGTCGAAGTGTTGATCTCGTTAACCTTATAAGAATAATTTGTTCGTCCAGTTTTGAGCTCGCGTCAAATGCGT
GAATCGATAATAAACAGAAGCGAAGTCTAGCAACTCAAACGCCAGCGAACGACTCATTCTCATAGCTCGCCACAAACGCCAGCGGCGGTGCTGCAGAAGA
TGGAGCTGCCGAGCAATGAGCAGAACTTTAGACGTCACTTACTTGTACCATGAGATCTGGCTTGTGAGGATATTACTCGCAGCCGCGTTGTTTGCAGTAC
GTCTTCCGTCTTGAGCCCTCTCACTTCGATTTCGGCGCCTGGAAACTCAAGCCAGAACTTAAGCCTTACGACTAGACTCGGAGAAATCCTCTAAAAGGTG
TGAGGACCAGCAGAAACCATTGGATCTGTTCGACTGCAACCGTGCATTTCAACACACAGAAATGGCTACTCTATATCGATGGTCGTATTTCCATACGTCA
CTCTTCTCCCCTCCTGTCACTCTTCCGCAGCCCATTGTCGCTTTGGCTGTCCGTCACCATGGCCAAGTCGCTGAACCCGATGGAGGCGTATCGGCGCGAG
CAGAAGAAGAAGGAGCTCAAGAAGCACCGGGTGGAACGGCAGAAGGACAAACAGTCAAAGCTGAGCTCTATGGACCCGGCAGAACTTCGTGAGCAACTCA
AGGCGCTCGAGCGGCAGGTGACCGGGAATCCGTCGGACGGCCCCACGCGCAAGCGCAAACAGGAGCTGGAGGAGACACTGCGGGCGGTGGTAAAGCGGCA
GAAGGAGGTGCGCGACGCTGTCTGAAGCTGCGGGAGTT