Description :
From Genome Similarity Track
Location :
contig_39:356413- 357451
Transcript NameFunction/comments
g8219.t1hypothetical protein
g8220.t1XP_009518815.1 hypothetical protein PHYSODRAFT_295880 [Phytophthora sojae

Sequence
1038 bases(100 bases per row)
CAGACAGTTCGGGCGGCGGCTGCGTCGTGGACAGCAAGTGGAAGGTCTGTCGGATGTGCGAGCGCAAGTTCTCGCCTATGAGCCTGAGTCGGCAGTACGC
GGACTGCTGCTCGCTCGACTGCAAGTCGGCCCTCATGTTCGGCCGCCACGTCGTGTAATCAGTCTCTCGTAGGCATCGGAACCTACGACTGTATTGACGT
CGAAGTATTGATCTCGTTAACCTTATAAGAATAATGTGTTCGTCCAGTTTTGAGCTCGCGTCAAATGCGTGAATCGATAATAAACAGAAGCGAAGTCTAG
CAACTCAAACGCCAGCGAACGACTCATTCTCATAGCTCGCCACAAACGCCAGCGGCGGTGCTGCAGAAGATGGAGCTGAAGAACTTTAGACGTCACCTAC
TTGTTCCATGAGATATGGCTTGTGAGGATAGTACTCGCAGCCGCGCTGTTTGCAGTACGTCTTCCGTCTTGAGCCCTCTCACTTCGATTTCGGCGCCTGG
AAACTCAAGCCAGAACTTAAGCCTTACGACTAGACTCGGAGAAATCCTCTAAAAGGTGTGAGGACCAGCAGAAACCATTGGATCTGTTCGACTGCAACCG
TGCATTTCAACACACAGAAATGGCTACTCTATATCGATGGTCGTATTTCCATACGTCACTCTTCTCCCCTCCTGTCACTCTTCCGCAGCCCATTGTCGCT
TTGGCTGTCCGTCACCATGGCCAAGTCGCTGAACCCGATGGAGGCGTATCGGCGCGAACAGAAGAAGAAGGAGCTCAAGAAGCACCGGGTGGAGCGGCAG
AAGGACAAACAGTCAAAGCTGAGCTCTATGGACCCGACAGAACTTCGTGAGCAACTCAAGGCGCTCGAGCGGCAGGTGACCGGGAATCCGTCGGACGGCC
CCACGCGCAAGCGCAAACAGGAGCTGGAGGAGACACTGCGGGCGGTGGTGAAGCGGCAGAAGGAGGTGCGCCACGCTGTCTGAAGCTGCGGGGGTTGGAG
ACGTAGCGACTGACGAGTTGTTGACTGTTGATGCAGAT