Description :
From Genome Similarity Track
Location :
Scaffold_531:3564- 7281
Sequence
3717 bases(100 bases per row)
GTTTTCGACATAGATGTAAGAGAAATCAATAATACCGCGCAATGGGTCCAGCCTGTAGCACCCAAATTATAAAAAAACAGGCCGATCTAGTCAGTGGAAT
TTATCGCCAAGATTTTCCGAAAATCTGTCGCACCACGGGCTTCGCTAATGTAGATATCATCAAAATAACGGCGAGCACATACGGCTGTGTATTGATTACA
GGTTGGTGATTCAGCTGACAAGATTAATGGTATACCCTATGCCTCAGAAGTGAAGTATTGCTGGACATAATAAGAGCTATATGGATTTTTTCCTTGATAT
GACGAGTGGGTTCAGGGTGGTTGAGACGACGGAACTAGCAAAATCGATCTTATTATCATCACATAGTCGGTTTTGTAGTGATTAAAGATGACTTTTGGGG
TGGTGTAGATTTACCAACATTTGATTGATATCGATATGTACGATACGTGAAAAATCTTGCAGGGGACTATTTAGTATCTACTGGATCGTCAAAGTCTGTC
GATGCACTAACTGAAGGTTTATTAGCCACCGATCTAAGATCATCGGTTTTGGGTCAGAGATCGCTTATCGATGACATACTGATAACTTCTGCATTGTGGG
ATTTCCTATACAAAAAAGTGAAGTAATTGTTCAATTAGTGAAATGGTTGTAATATTTCGATCATCTGCGCTCAAGGTTTCTAGGGACGTGATAAGGTGTA
ATAGATAGGGCTTAATGTTTGCTGGCAGGTTTGGAAGCTAATCCAAAAATCTGATATTGCTGGTGCGTAACCATTTCCTCGGACGCTACGATTGATGTTG
TCAGTTCTTCGAAGTATAAATTACGATAGTAGATTCATTGAGAACTTTGCAATATATGCGTCCGTGCTGTATAAGATTTTTGAAGCATATTTCCATGACA
TCAACCCCGCAAGTCATGTCAGACGTCGATCCTTGATCCAGACTGGATCGCGATCGCAACTCCCCGAATATATACAAGCCCGATCTCGACTCAAAATAAT
GGGGATGATTAAGATTCAAAGGGAGGTGATGTTGGCAAAAGTATGGTATCGCCTCAACGTTTTTTGAAAACAAAGTAGCTAAAATGCTGATTTTGATGCA
TTTAGATCAGGATCGGCTGCCGGTGATAGTAGTATATGCTACTAAGTGGGCACTGTCGGCTGCGTTACTTTTTGAGCACGAAGGTGTATACTAGACGGTC
AACTCTCCGATCCTACGCTGACGACTAACCAATTTTTTTAATATGGTCAAGAATGNNNCAATAGATTTTCTTCAGATATTGTATATTACTTACACTGTGC
TGATGTCACACATGATTGCGATGCATACGTGATCATTACACTGGCATGGTTGCTACCATCTGAGTGTCTCAACAGAGATTCGGGAAGGTCGGTATACTTA
TTTTCAAACTGTACTTAGAGATCTGCCAACCTAAAAAGGGTAAGATGAGAAACTTGGCATGCTGGATTCAAGTATACATCTCGCGAAGTAGTGAATGAAG
TCTTAATAAGGATTATCCCACGAAAGTAGCCTATGGTTTTTGTCTACTCTGACGGTAGGAGGTGGCATGCTTAAGCAGCCAGGGCAGACAATAAGAATGT
CACCTCTTACCCTCAGAGTAGACAAAAACTTCTAGTGGCCCATTTTGATAGGTCGTCTAGAATGAAGCAGAATAGTGGGGCAATAAGCAAAATCGTATAG
ACTTCGTCGGAATATAAGATCGTAGTGGATGCTTCCGTGTATACCCCTGATCTGACTATGAAAAAAGCGTAGTACCGAGTATTTCTCCTCTACTTTAACT
AGACCGCTGATCAACCAAGGAATTGGTAATTATTTGCGAATACTTCAAACTGAATGATCTTTCAAATGCGAAAATAGATTGACTGCAAAGCACCAGGGTT
GAATTTGCTGCATCATACATATGTAAAGAGACTCATTGTGGCCAATTAATAGGTTTTTACATATGAAGTGGGACTAGTACAAGTGTATAAATTAGCTAGC
AAGCGGGGATCTACAGCGAGATAAGAGACTAATCTCTGATCATGACCGTCTGGACCTGATCACTCTTAATCAGTTAGGATAACTACTACTACCAGAATGA
GTCTATAACTTATTTAATGGGGTCGCAGGTTATCAATCTATCCGCATCGAGAAGATGCTGCCAGAACAAGAATTTACAGGAAGCGGTCGTGCAGAAGTAT
GGATCAATCGTATCATCCAAGAGGAAGACTAATTGCTATATAACTTATATTCATTTATATATTTTTGAATGGAGATGTGGCTAGGCTATCGGCGACAGAG
ACAAACGCTGTACCCTATTCGCACCTAATAATGAGATAAATCAAAGTGGATTGCTATATTGATGGAAGAGGTCAGTCACGCAATTGTAATGTCGTGCTTA
GGCGGTTAGCTTGATAGGTCCTAAAGTTCCTACAGCGAAAATGATTGCACCACTACTATACAAGTCTGGACGGTGGTGGCTGAGGAATTAGCCGCATCCA
TAATAAATTCTCATTGGACAAGTTTAAACAGAAATGTGCAGCGGTATGTGGTATAATATGTTGATTTTGATACGGTACACGGATAACTCTATGATCGGAG
CGTATCTCCTGATAATTTACAAGCGACATAGCTTTTTAAAGTATTGGACAACAATCACATTTCTTCATTGCCGCGATCTTTTAAATGGAACATAGAGCTT
TTATGGTGCATTAATCGTTTTCTAGGTTTATGATCGTAACATCGATTCGTCCAGAAATGCACAATCTCTTGCAAAGAACTGTGAATTATTTTTATTTATA
CAGATTGGTGGAAGCGAGGCAAGTCCAATTTCTCTCGAGCGCTAAATTAGGTCTCGGAAAAACGGCGATCCACCATGGTAGGTAAATGGCAAGCCAATGA
TAAATAAATAAATATGGTGCGGACACTTACNNNNNNNNNNGATCAAGAAGCGCGTCAGGGGCGGAAACATAAAGATTAGGACTAATCGGTATTAAGATTT
GTTTATACATATAGTTCCCGGAGTATCAAGTGAGTTAGGGATAAGCCATTTTGCTTTATTCACGGGTGGTACGTACGCTTGACATTTAAAGCAAACTTTT
CGCTAGGATCGGCCTGGCCTTTGAAATTTCGGACCCACGATGGTGGCGTATGGCATACAACACCAGTATAAATGTGTAAGGGATGTGGTGAACGAGCGAC
TTAAGACCTAAATCTAATATCGTGCTGATCGGTATGCCAAGGAGCCATACCGACAATCCTGTGATATGGTTTGCAGATCGCAGGCTTGTATGCATGGATC
GCGTTCAGGAGGGGTATGCTTAAAAACTAGCCCGTATGTGGCATGGACCGTATGTGTAGCATAAATGTGTGGCGATCTCGCGGTGCTATTGTAAAAAGTG
GGTACGCACTACCTGCTATTCCCGGTGGCTCATTTTTATACAAATCAAGTCAAGGTCTTCCCATAGCACCCTACAAATCAGTCAAATGTGGATGAGACGG
ATCGAATCGGTTTTTTACGAAGCCTTGGTGTCAGAAGTTAGTAAAGAGGGTGATCTAGATGCGGATTAATATGAAGAGGATGCGAGTATTGATATTCAAT
CAAGATGGAAGATTAAATATGGGAATAAATACAGGTAGTACTCGGTAAATAGAAGGAATATCACGATCTGTCTTAAATCGACGAATATGGTCTAAATTGT
GGAGCTTTGTTGTAGGA