Description :
From Genome Similarity Track
Location :
Scaffold_160:35637- 37491
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.19Endomembrane protein 70

Sequence
1854 bases(100 bases per row)
ATTCACACAGGCAGATCTTTGAGAGCCGCCGCCTGTCACCATTTAGAGCCCTTCGAAAAAAACCATGTCCGCTATAGATAAATTCAGCTTACTTGAATTT
TTATTGGCTAAAATGATGTGTAGATTTACAAATACATGATTATGAGTGGTCATAAATACGTTCTATGGAGCATCAACGAATCTGTAGTTGTTTGCTTATT
GCTTATCAACAGACTTGTCCATCTGCTTGAACATTTTTACGCTGTTATCATTTCTTCAGACGACTCGAGACGCGCAGATCGGAAGGAAGCTCGTAGCGGC
GGAGACCATGAAGATTGTACCGTCGGTGGCGATGCGCGAGAACGTCACGCGGTGGGGGTACCTGGCGTTCGCGCTGGCGATGCTGCGGCTCGTGCAGCGT
GCACGCGACAAAGACGTCGCGAAGGAGGTGCGTGCGACAGAGTTCTGTCATATTCTCACGGACGCACATGCTGTTGGCTAATGCACGAATATGCGCTGCG
CTATTGCTTTCCGTTGTATAGAACATGCTGAGCTTTGCGGCGGCGCTGCTGCCGACGGAGCTCTCGCACAAGTTCCTGGCGCTGAATGCCGGCGTCGTCT
ACTGGCTCAAGAGATCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGTGCATCGTCATGATC
CGCTTTCTCAGTATCTACCAGAGCAACATCAACGCGAAGCACAGTATCCGAAGTGCAATGGAGGAGCAGTCGGACATCCCACCGGACACGCTGCAGCACA
TTGGCGAGCTGAGCGTCCGCAATTGGCTCACGGTTATGCTCCCACTGCCCCAGACAATGGCGCTCTCCTTGAGCTACCCTGGCGTGACTGTTACCGAAGG
CATTGTGTTCGCCCACGTGGGCAAGAACAGCACGACTAAGCTGCGCATGGATGTGTACAAACACAAGGACGCGCAGCCGAATGCGCCGATCTTCCTGTAC
ATTCANNNNNNNNNNNNNNNNNNNTGGATCATGGGGGACCGCAAGAACCCGCCACGGCCACTAGTGTACCAGGTCGCGAGCCTTGGCTGGATTGTGTGCG
TCATTGACTACCGATTATCGCCCAAGATCGCGTTCCCAGAGCACCTGGTCGACTCGAAGCGCGCGATCGCGTACTTACGAGACCATGCACGTACAGAATT
CGGCGCCGACCCCGAGTACATTGTGGTCGGTGGCGAATCTGCTGGCGGTCACTTGGCGAGTCTCGTTGCACTNNNNNNNNNNNNNNNNNNNNNCGACAAA
TCCCTGCAACCGGGATTCGAAGACGTCGACACGAGCGTCCGTGGATGCATCGACACGTACGGCGTCCACGATTTCAAAGATCGTCACGGGATTTACTTTA
CCAAAGACAGAGGATACTCGTTCGTTCGCTTCATTGAGCTGCTCGTGATGCAGAAAAAGCTCAAGGAAGCCGGTGACGACTACGATCAAGCGTCTCCGAT
CAGCTGGGTCGAAGAACTCAAGACGTCCGAGCGCGAGGACATCATCCCGCCGTTCCTGGTCGGCCACGGAACCCACGATACGCTGGTCCCGTTCAAGGAC
TCGCTGTTGTTTTTCGAGAACTTGCAGAAATACCGGCAACGAACGAGCAACCAGAGCGATCGCCCAGCCTCCATCGCTGGTATCGAGGACGTGTTTCTCG
AGATCCCCGATGCCCACCATGCGTTCAACTACTTGGCGTCACCACGAGCGCTTGCATATGGAGATGCTGTGTGCGTGTTCCTAGCGAACCTTTATGCGAG
AACCAAGCACATTCCGTTGCGAGCCGCAGCGCACGTGACGGCTGATCAAGTGGA