Description :
From Genome Similarity Track
Location :
contig_26:35631- 38755
Transcript NameFunction/comments
g5439.t1hypothetical protein
g5440.t1hypothetical protein

Sequence
3124 bases(100 bases per row)
AGCTGGAAGCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAA
TCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTAC
AAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAA
CGAAGTATGCGTCACGCGACAGTACGTGGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCC
GCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACG
CCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTG
AGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAAC
AGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATG
TGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGAT
ACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAA
CTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTG
CATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATT
CCACGTTGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTACTACCAATCGCGTCAGCTGAAGC
CAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGT
GGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTC
CAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCG
TCGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGATAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGGGAGTACTTCTCCACACC
TTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGAC
AACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTGACCCCGACATCGGGACATCCTGGCCGTGAGAAGACATA
TTTGCTTCTCACGCGTGACTTCTATGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCA
ACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAG
GACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTC
GACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTG
GGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCA
CTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCC
ATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTG
ATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGA
CAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACA
AGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAAA
GTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCA
CCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCA
GCACGAGTCACCTACGTCTGGTGA