Description :
From Genome Similarity Track
Location :
Scaffold_464:3563- 4914
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_464-snap-gene-0.6Proly 4-hydroxylase
Pytar_ATCC12531maker-par_contig_464-snap-gene-0.7Conserved gene of unknown function

Sequence
1351 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGCGACCGACAAGATGAGCCTCCACGGTGGATGCC
CCGTCGAGGACGGCGTCAAGTACTCGGGCAACAAGTGGGTCTGGAACAAGCCGCGTACGGACTGAGGAACGAAGCCCAGCGGTGTGGTTTGCAAAAGTGG
ATACATTTTCCCTGCATTATTCAACCCATGTTCCGGAATATTCCCGATATATTACCGTTGAAACAGGCCAAAATACCGTATTTTCCCCAGTCCGTTTCTC
TCTGCCACATATTCTCAGACTCAGATCGCCCATTTTTTTGTTTTGTTTTTTTCGTTTGTTCTTTTCTTTTCCACTTCTTGGCGTCAATCGAGCAGCGCCA
TTTTCGTCTCACCTTCTCCACGAGCTCCATGGACTTCTTGACCAAGATCTGCCTCTTTGGCGAGGGCCACTGCTTCCACACGCAGTCCGCGGCGGCCTCC
TCCGTCTACGTCTACGCGATCGCGCTCGCCTACACTGTCTCGGTGAGCTTCCAGCGCGGCCGCCTCGGCGAGCACGGCCACGCGACGCATCTTCTCCCGG
TCAAGCGCATGAAATGGTTCCCGACGTTCCTGAGCTTTTCCTACTTGTGCCGCATCGGGTGGCTACTGCTAAGCGAGATGCACGCGTTCGAGTGGGTCGA
AGGCACGGCGCCCAACTACTCGTATGAGCACACGATCATCACGGTGCCGTTTCTCCCGACGTCCATCGACATGTACGTGCTCACAGTCACGTCGCTCAAC
AAGCTCGCGACGCTGCTCTACTTTTCGGCCTTCACACTGCTGCTGCGCTTCTGGGAGGACGTTCTCCATCTCGCGCAGCGCGCCGAGAAGCCGCTCGCGC
GTATCGCAGCGAACCAGTCGGTCATTGCCGAGTACACGCGCACGAGCACGCAGCAGCAACTGCGCACGCGCAAGATCTTCGTGGTCGCCAACGTCTGGAT
CTACCTGCTCGAGTTTGCGCTGCTCACGCTCAAGACGCTGTTCCCGCACGAAGAGAGCTTCATTTTCCAGGCCGACTATGCCGTCGTCGCGATGTTTTTC
TTTCTGCTCGCCGTCATGCTCGCGCGGTGTGCCTACAAGCTGCGCCAGGTGCTGCTTAAGATTGAGTTCTCGTCCCTCGCGACCAGTCTTGCGTGGCGCG
TCACGTGGCTCGGCGTGGTCGCGTCGCTCATTTTCTTCTTGCGCAGTCTCCTCCTTGTCATTGCCACGCCCGCCATGTTTGAAGTCTTTGACCCGCACCG
ATCCAACCCGTGGCTTTTCTACACGCTGCCCGAGATCGTGCCGGGCGTGTT